Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Bcr Abl |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

14/10/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de material de uso laboratorial, tais como: Solução, lisozima, cloreto, pipetas, microtubos, ponteiras, tampão, etc, destinados as Seções de Bacteriologia, Meio ambiente e Virologia do IEC. Atendendo as SBC´s SABMI 004, 005, 011, 018, 034, 035, 036, 054, 059, 060, 061 e 076/2016; SAMAM 072/2016; SAVIR 052/2016.

Lote 37: LABORATORIO DIDATICO MOVEL. SONDA PARA DETECÇÃO DE TRANSLOCAÇÃO 9/22-LEUCEMIAS (BCR/ABL). Frasco para 10 testes. ITEM 07 DO SBC SAMAM 072/2016..

21/09/2016 - MG: COMPRAS MG

EXAME LABORATORIAL BCR - ABL QUANTITATIVO

20/09/2016 - MG: COMPRAS MG

EXAME LABORATORIAL BCR - ABL QUANTITATIVO.

26/08/2016 - PI ( TERESINA ): MINISTÉRIO DA EDUCAÇÃO/EMPRESA BRASILEIRA DE SERVIÇOS HOSPITALARES EM TERESINA (UASG: 155008)

Prestação de serviço referente à realização de exames de imuno-histoquímica, imunofluorescência direta e patologia molecular para complementação dos exames oferecidos pela Unidade do Laboratório de Anatomia Patológica do Hospital Universitário ? HUPI/EBSERH.

Lote 13: LABORATORIO DIDATICO MOVEL. Pesquisa de BCR-ABL, através do método de FISH.

10/08/2016 - PA ( BELÉM ): GOVERNO DO ESTADO DO PARÁ/SECRETARIA ESPECIAL DE ESTADO DE PROMOÇÃO SOCIAL/SECRETARIA EXECUTIVA DE SAÚDE PÚBLICA/HOSPITAL OPHIR LOYOLA (UASG: 925450)

Aquisição de Material técnico para Laboratório de Biologia Molecular

Lote 1: MATERIAL DE SOBREVIVENCIA. Ensaio para expressão gênica tipo Taqman ou equivalente, inventoriado, do gene fusionado BCR-ABL que englobe três ou mais pontos de quebra distintos com dois ou mais marcadores, capaz de realizar no mínimo 250 reações..
Lote 3: MATERIAL DE SOBREVIVENCIA. Primer flanqueador para amplificação do material genético na região B2A2 do gene fusionado BCR-ABL, customizados com as sequências AGCATTCCGCTGACCATCAATAA (Forward) utilizando sonda do tipo FAM com anelamento na sequência CTGAAGGGCTTCTTCC..
Lote 4: MATERIAL DE SOBREVIVENCIA. Kit de PCR em tempo real sensível com resposta molecular de até 4.5 (RM4.5) e multiplexado com o gene BCR-ABL e ABL, com utilização prevista para monitorar os níveis de genes de fusão BCR-ABL de pacientes com Leucemia Mielóide Crônica (LMC). O ensaio é iniciado com RNA como entrada para a reação de transcrição reversa (RT) a fim de gerar o cDNA, e a partir dele é feito o PCR quantitativo. Todos os reagentes necessários estão presentes no kit. Capaz de realizar pelo menos 40 reações.
Lote 5: MATERIAL DE SOBREVIVENCIA. Primer flanqueador para amplificação do material genético na região B2A2 do gene fusionado BCR-ABL, customizados com as sequências AGGCTCAAAGTCAGATGCTACTG (reverse), sonda do tipo FAM com anelamento na sequência CTGAAGGGCTTCTTCC..
Lote 6: MATERIAL DE SOBREVIVENCIA. Primer flanqueador para amplificação do material genético na região B3A2 do gene fusionado BCR-ABL, customizados com as sequências GTTTCTGAATGTCATCGTCCACTCA (Forward), utilizando sonda do tipo FAM com anelamento na sequência CAGAGTTCAAAAGCCC..
Lote 7: MATERIAL DE SOBREVIVENCIA. Primer flanqueador para amplificação do material genético na região B3A2 do gene fusionado BCR-ABL, customizados com as sequências GATGCTACTGGCCGCTGAA (reverse), utilizando sonda do tipo FAM com anelamento na sequência CAGAGTTCAAAAGCCC..
Lote 8: MATERIAL DE SOBREVIVENCIA. Primer flanqueador para amplificação do material genético na região A2-3A3 do gene fusionado BCR-ABL, customizados com as sequências TTGTGGCCAGTGGAGATAACAC (Forward), utilizando sonda do tipo FAM com anelamento na sequência CCGGAGCTTTTCACCTTT..
Lote 9: MATERIAL DE SOBREVIVENCIA. Primer flanqueador para amplificação do material genético na região A2-3A3 do gene fusionado BCR-ABL, customizados com as sequências GCTTCACACCATTCCCCATTG (reverse), utilizando sonda do tipo FAM com anelamento na sequência CCGGAGCTTTTCACCTTT..

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2016 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.