Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Dessaliniz |

Atualizado em 26/12/2016. Acesse também licitações mais recentes e baixe os editais.

13/12/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos de uso laboratorial, tais como: oligonucleotídeos, sondas, kits e reagentes.

Lote 1: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR ZIK NS5 ****. Descrição: Sequência: 5 - AAR TAC ACA TAC CAR AAC AAA GTG GT-3 . Escala de síntese: 250 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 01 SAARB 092/2016).
Lote 2: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR ZIK NS5 ****. Descrição: Sequência: 5 - TCC RCT CCC YCT YTG GTC TTG-3 . Escala de síntese: 250 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 02 SAARB 092/2016).
Lote 4: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR - ZIKAV ENV ****. Descrição: Sequência: 5´-CCGCTGCCCAACACAAG-3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 04 SAARB 092/2016).
Lote 5: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR - ZIKAV ENV ****. Descrição: Sequência: 5´-CCACTAACGTTCTTTTGCAGACAT-3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 05 SAARB 092/2016).
Lote 7: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR VDEN **** F. Descrição: Sequência: 5´- GGTTAGAGGAGACCCCTCCC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 07 SAARB 092/2016).
Lote 8: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR - VDEN **** R. Descrição: Sequência: 5´- GAGACAGCAGGATCTCTGGTCT -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 08 SAARB 092/2016).
Lote 10: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR RNASE P F. Descrição: Sequência: 5 - AGA TTT GGA CCT GCG AGC G -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 10 SAARB 092/2016).
Lote 11: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR RNASE P R. Descrição: Sequência: 5 - GAG CGG CTG TCT CCA CAA GT -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 11 SAARB 092/2016).
Lote 13: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador Ph-M-2FM . Sequência: 5´- GGVMTSMTHAATTAYCAGTGYCA -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 01 SAARB 094/2016).
Lote 14: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador Ph-M-3RM. Sequência: 5´- CAYCTYCKNGARCTNARRCA -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 02 SAARB 094/2016).
Lote 15: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador PHLV- END . Sequência: 5´- GGGGGGGGGGACACAAAG -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 03 SAARB 094/2016).
Lote 16: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador PH-S-DR-RVF . Sequência: 5´- AAAGCTGGGGTGCATCAT -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 04 SAARB 094/2016).
Lote 17: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador BUN-S. Sequência: 5´- AGTAGTGTGCTCCAC-3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 05 SAARB 094/2016).
Lote 18: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador BUN-C. Sequência: 5´- AGTAGTATACTCCAC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 06 SAARB 094/2016).
Lote 19: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador BS-S256. Sequência: 5´- GTGGGGTCCAATTTGC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 07 SAARB 094/2016).
Lote 20: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador BS-C256. Sequência: 5´- TGAACCCTATGCATCT -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado.Oligonucleotídeo sintético personalizado iniciador BS-C256. Sequência: 5´- TGAACCCTATGCATCT -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 08 SAARB 094/2016).
Lote 21: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador NPhlebo1 (S). Sequência: 5´- ATGGARGGITTTGTIWSICIICC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 09 SAARB 094/2016).
Lote 22: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador NPhlebo1 (NS). Sequência: 5´- AARTTRCTIGWIGCYTTIARIGTIGC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 10 SAARB 094/2016).
Lote 23: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador NPhlebo2 (S). Sequência: 5´- WTICCIAAICCIYMSAARATG -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 11 SAARB 094/2016).
Lote 24: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador NPhlebo2 (NS). Sequência: 5´- TCYTCYTTRTTYTTRARRTARCC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 12 SAARB 094/2016).
Lote 25: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador cFD2 (S). Sequência: 5´- GTGTCCCAGCCGGCGGTGTCATCAGC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 13 SAARB 094/2016).
Lote 26: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador MA (NS). Sequência: 5´- CATGATGGGRAARAGRGARRAG -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 14 SAARB 094/2016).
Lote 27: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador MAY 1 (M2W). Sequência: 5´- YAGAGCDTTTTCGCAYSTRGCHW -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 15 SAARB 094/2016).
Lote 2: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR ZIK NS5 ****. Descrição: Sequência: 5 - TCC RCT CCC YCT YTG GTC TTG-3 . Escala de síntese: 250 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 02 SAARB 092/2016).

01/12/2016 - SP ( SAO PAULO ): INSTITUTO ADOLFO LUTZ

MATERIAL DE CONSUMO

Lote 1: 12 ODS.DESSALINIZADOS, LIOFILIZADOS,COM CERTIFICADO DE ANALISE, VALIDADE MINIMA DE 01(UM) ANO A CONTAR DA DATA DE ENTREGA NO ALMOXARIFADO, ACONDICIONADO EM FRASCO APROPRIADO, ROTULO COM NR. DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO, PROCEDENCIA E EMBALAGEM APROPRIADA P/ PRODUTO

28/11/2016 - DF ( BRASÍLIA ): MINISTÉRIO DO MEIO AMBIENTE/AGÊNCIA NACIONAL DE AGUAS (UASG: 443001)

Aquisição de coleções e materiais bibliográficos digitais (e-books) ou impressos existentes no mercado nacional e estrangeiro.

Lote 74: LIVRO. Dessalinização de Águas.

09/11/2016 - PB ( CAMPINA GRANDE ): UNIVERSIDADE ESTADUAL DA PARAÍBA - UEPB

PE 074/2016 - AQUISIÇÃO DE DESSALINIZADOR PARA A PRÓ-REITORIA DE INFRAESTRUTURA DA UNIVERSIDADE ESTADUAL DA PARAÍBA - UEPB.

08/11/2016 - SP ( CAMPINAS ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/SECRETARIA DE DEFESA AGROPECUÁRIA/COORDENAÇÃO GERAL DE APOIO LABORATORIAL/LABORATÓRIO NACIONAL AGROPECUÁRIO - LANAGRO/SP (UASG: 130102)

Pregão SRP para aquisição de insumos de biologia molecular grupo 162.

Lote 8: MEDIDOR LABORATÓRIO. OLIGONUCLEOTÍDEOS ( PRIMERS ), DESSALINIZADOS, ESCALA DE SÍNTESE 50 NM, SINTETIZADOS A PARTIR DE SEQUÊNCIAS ENTRE 7 E 100 BASES. A EMPRESA DEVERÁ FORNECER OS OLIGONUCLEOTÍDEOS DE ACORDO COM AS SEQUÊNCIAS INFORMADAS PELA UNIDADE DE SANIDADE AVIÁRIA E CONFORME AS NECESSIDADES DO LANAGRO-SP..

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.