Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Espectrometria Massas |

Atualizado em 31/10/2016. Acesse também licitações mais recentes e baixe os editais.

24/10/2016 - MG ( ALFENAS ): MINISTÉRIO DA EDUCAÇÃO/ESCOLA DE FARMÁCIA E ODONTOLOGIA DE ALFENAS (UASG: 153028)

Aquisição de material de consumo químico e farmacológico.

Lote 182: DOSADOR QUIMICO. **** - Kit para determinação de creatinina reação cinética de dois pontos (para automação), baseada no método de Jaffé, que forneça resultados rastreáveis ao método definitivo IDMS ( diluição isotópica, espectrometria de massa) e que atendam às recomendações do National Kidney Disease Education Program (NKDEP) para padronização da dosagem de creatinina no soro. Kit para 100 testes..
Lote 183: DOSADOR QUIMICO. **** - Kit para determinação de creatinina reação de ponto final, baseada no método de Jaffé, que forneça resultados rastreáveis ao método definitivo IDMS (diluição isotópica, espectrometria de massa) e que atendam às recomendações do National Kidney Disease Education Program (NKDEP) para padronização da dosagem de creatinina no soro. Kit para 100 testes..

19/10/2016 - PA ( BELÉM ): FUNDAÇÃO DE AMPARO E DESENVOLVIMENTO DA PESQUISA (UASG: 925848)

Aquisição de material de consumo para laboratório.

Lote 20: REAGENTE PARA TINTA. OLIGONUCLEOTIDEOS - IDT 02 OLIGOS SINTETIZADOS EM ESCALA INICIAL DE 100 NMOL, TOTALIZANDO 38 BASES, RENDIMENTO MINIMO GARANTIDO DE 6 O.D. PURIFICACAO PADRAO. TODOS OS OLIGOS SAO CHECADOS INDIVIDUALMENTE NO CONTROLE DE QUALIDADE (QC) POR ESPECTROMETRIA DE MASSA. MARCA: IDT. PROCEDENCIA: ESTRANGEIRA (EUA) ID..

05/10/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de materiais de uso laboratorial, tais como: testes, oligonucleotídeos, superscript, kits, reagentes, etc.

Lote 3: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores COG2F 5 CAR GAR BCN ATG TTY AGR TGG ATG AG 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 01 SAVIR 030/2016).
Lote 4: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores G2-SKR 5 CCR CCN GCA TRH CCR TTR TAC AT 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 02 SAVIR 030/2016).
Lote 5: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores EVP2F-P2 5 GTR CCR CCH ACA GTT GAR TCA 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 03 SAVIR 030/2016).
Lote 6: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores EVP2R-P2 5 CCG GGC ATA GTR GAY CTR AAG AA 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 04 SAVIR 030/2016).
Lote 7: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores Hex1Deg 5 -GCC SCA RTG GKC WTA CAT GCA CAT C-3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 05 SAVIR 030/2016).
Lote 8: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores Hex2Deg 5 -CAG CAC SCC ICG RAT GTC AAA-3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 06 SAVIR 030/2016).
Lote 9: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores NeHex3Deg 5 -GCC CGY GCM ACI GAI ACS TAC TTC-3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 07 SAVIR 030/2016).
Lote 10: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores NeHex4Deg 5 -CCY ACR GCC AGI GTR WAI CGM RCY TTG TA-3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 08 SAVIR 030/2016).
Lote 11: DOSADOR QUIMICO. Síntese de Oligonucleotídeos. Escala de 100 nmol, utilizados Para técnica de PCR e suas variações (RT-PCR, Nested e Semi Nested PCR). O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. Quantidade 600 bases (Seiscentas bases) (Item 09 SAVIR 030/2016).
Lote 12: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores JV12Y - 5 ATA CCA CTA TGA TGC AGA YTA 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 01 SAVIR 031/2016).
Lote 13: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores JV13I - 5 TCA TCA TCA CCA TAG AAI GAG 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 02 SAVIR 031/2016).
Lote 14: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores G1 - 5 TCN GAA ATG GAT GTT GG 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 03 SAVIR 031/2016).
Lote 15: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores Noro II-R - 5 AGC CAG TGG GCG ATG GAA TTC 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 04 SAVIR 031/2016).
Lote 16: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores Mon 431 - 5 TGG ACI AGR GGI CCY AAY CA 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 05 SAVIR 031/2016).
Lote 17: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores Mon 432 - 5 TGG ACI CGY GGI CCY AAY CA 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 06 SAVIR 031/2016).
Lote 18: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores Mon 433 - 5 GAA YCT CAT CCA YCT GAA CAT 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 07 SAVIR 031/2016).
Lote 19: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores Mon 434 - 5 GAA SCG CAT CCA RCG GAA CAT 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 08 SAVIR 031/2016).
Lote 20: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores P269 - 5 CAA CTC AGG AAA CAG GGT GT 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 09 SAVIR 031/2016).
Lote 21: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores P270 - 5 TCAGATGCATTGTCATTGGT 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 10 SAVIR 031/2016).
Lote 22: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores CAP A - 5 GGC WGT TCC CAC AGG CTT 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 11 SAVIR 031/2016).
Lote 23: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores CAP B2 - 5 TAT GTI GAY CCW GAC AC 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 12 SAVIR 031/2016).
Lote 24: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores CAP B1 - 5 TAT GTT GAC CCT GAT AC 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 13 SAVIR 031/2016).
Lote 25: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores CAP C - 5 CCT TYC CAK WTC CCA YGG 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 14 SAVIR 031/2016).
Lote 26: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores CAP D1 - 5 TGT CTR STC CCC CAG GAA TG 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 15 SAVIR 031/2016).

03/10/2016 - GO: SECRETARIA DE ESTADO DA SAUDE

EQUIPAMENTOS, INSUMOS DE LABORATÓRIO (DIVERSOS)

Lote 1: Sistema de Espectrometria de Massas (LC/MS/MS)

03/10/2016 - ES: SECRETARIA DE ESTADO DE SEGURANÇA PÚBLICA E DEFESA SOCIAL - SESP -/ POLÍCIA CIVIL - PC-ES -

Contratado Aquisição de Consumíveis para o Cromatógrafo Gasoso Acoplado a Espectrometria de Massas (CG-MS), do Laboratório de Química Legal da PCES Processo nº: **** Valor Total: R$ ****,77 (vinte e dois mil, oitocentos e sessenta e quatro reais e setenta e sete centavos) Vitória, 30 de setembro de 2016. Marília Brostel Corrêa Meneghim Presidente da CPL/PCES RATIFICO E HOMOLOGO A INEXIGIBILIDADE DE LICITAÇÃO EM TODOS OS SEUS TERMOS. Vitória, 30 de setembro

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2016 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.