Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Oligo |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

PR ( CURITIBA ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE FEDERAL DO PARANÁ/PRÓ-REITORIA DE ADMINISTRAÇÃO/DEPARTAMENTO DE SERVIÇOS GERAIS/HOSPITAL DE CLÍNICAS (UASG: 153808)

Implantação de Sistema Registro de Preços, com vigência de doze meses, para aquisição parcelada, conforme necessidade, de insumos laboratoriais (goma adragante, enzima e outros) O objeto atenderá o Hospital de Clínicas da UFPR, conforme especificações detalhadas em edital e anexos.

Lote 59: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 25 NMOL.

PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos para uso laboratorial, tais como: Água ultrapura, enzimas, ácidos, antígenos, kits, padrão, tampão, etc. Destinados as seções de pesquisa do IEC. Atende TR: SABMI: SAPAR: 21, 34/2016; SAPAT 06/2016; SAMAM 15, 59, 138/2016.

Lote 68: DOSADOR QUIMICO. Confecção de oligonucleiotídeo MARCADO COM ROX. Invitrogen ou similar com as mesmas especificações técnicas. Exigimos no ato da licitação comprovação de distribuidor autorizado do produto a fim de assegurarmos as especificações técnicas e a qualidade do produto, sobretudo no que diz respeito a temperatura de manutenção dos insumos durante o pré armazenamento e transporte ao laboratório fim Atende item 3 do TR SAMAM 138/2016..

PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de materiais de uso laboratorial, tais como Bromophenol, anticorpos secundários, microarrays, oligos, sondas, kits reagentes e etc., destinado a atender as Seções do IEC, SAPAR 86/2016; SAMAM 157/2016; SAHEP 40/2016; SABMI 32/2016; SAARB 28, 80/2016

Lote 7: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR CHIK 874F. Sequência: 5 - AAA GGG CAA ACT CAG CTT CAC-3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas e que seja da mesma marca dos itens 5 a 22 deste TR. Apresentação: 1 (um) frasco contendo oligonucleotídeo liofilizado. Atende item 1 do TR SAARB 28/2016..
Lote 8: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR CHIK 961R. Sequência: 5 - GCC TGG GCT CAT CGT TAT TC-3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas e que seja da mesma merca dos itens 5 a 22 deste TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 2 do TR SAARB 28/2016..
Lote 10: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR CHIK ****. Descrição: Sequência: 5 - TCA CTC CCT GTT GGA CTT GAT AGA-3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas neste PBS Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 4 do TR SAARB 28/2016..
Lote 11: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR CHIK ****. Descrição: Sequência: 5 - TTG ACG AAC AGA GTT AGG AAC ATA CC-3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas neste PBS Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 5 do SAARB 28/2016..
Lote 12: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE 5 6-FAM/ZEN/3 IBRFQ CHIK **** Descrição: Sequência: 5 - AGG TAC GCG CTT CAA GTT CGG CG -3 . Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 6-FAM, Int ZEN, 3 Iowa Black FQ, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas neste PBS. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 6 do TR SAARB 28/2016..
Lote 13: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR CHIK ****. Descrição: Sequência: 5 - AGG GCA GAG AGG ACA GAA CA -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas neste PBS Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 7 do TR SAARB 28/2016..
Lote 14: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR CHIK ****. Descrição: Sequência: 5 - GCA GGA CTG GTA CTG GTG GGC G -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas neste PBS Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 8 do TR SAARB 28/2016..
Lote 15: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE 5 6-FAM/ZEN/3 IBRFQ CHIK **** Descrição: Sequência: 5 - GTG GTA GGG CGG ATT AGT CA -3 . Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 6-FAM, Int ZEN, 3 Iowa Black FQ, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas neste PBS. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 9 do TR SAARB 28/2016.
Lote 16: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR DEN-1 F. Descrição: Sequência: 5 - CAA AAG GAA GTC GYG CAA TA-3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 10 do TR SAARB 28/2016..
Lote 17: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR DEN-1 R. Descrição: Sequência: 5 - CTG AGT GAA TTC TCT CTG CTR AAC-3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 11 do TR SAARB 28/2016..
Lote 18: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE 5 6-FAM/BHQ1 DEN-1 S. Descrição: Sequência: 5 - CAT GTG GTT GGG AGC ACG C -3 . Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 6-FAM, 3 Black Hole Quencher 1, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo fosco contendo oligonucleotídeo liofilizado. Atende item 12 do TR SAARB 28/2016..
Lote 19: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR DEN-2 F. Sequência: 5 - CAG GCT ATG GCA CYG TCA CGA T -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 13 do TR SAARB 28/2016..
Lote 20: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR DEN-2 R. Sequência: 5 - CCA TYT GCA GCA RCA CCA TCT C -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 14 do TR SAARB 28/2016..
Lote 21: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE 5 6-HEX/BHQ1 DEN-2 S. Sequência: 5 - CTC YCC RAG AAC GGG CCT CGA CTT CAA -3 . Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 HEX, 3 Black Hole Quencher 1, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 15 do TR SAARB 28/2016..
Lote 22: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR DEN-3 F. Descrição: Sequência: 5 - GGA CTR GAC ACA CGC ACC CA -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 16 do TR SAARB 28/2016..
Lote 23: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR DEN-3 R. Descrição: Sequência: 5 - CAT GTC TCT ACC TTC TCG ACT TGY CT -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 17 do TR SAARB 28/2016..
Lote 24: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE 5 6-TEXAS RED/BHQ2 DEN-3 S. Sequência: 5 - ACC TGG ATG TCG GCT GAA GGA GCT TG -3 . Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 Texas Red, 3 Black Hole Quencher 2, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 18 do TR SAARB 28/2016..
Lote 25: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR DEN-4 F. Sequência: 5 - TTG TCC TAA TGA TGC TRG TCG -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 19 do TR SAARB 28/2016..
Lote 26: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR DEN-4 R. Descrição: Sequência: 5 - TCC ACC YGA GAC TCC TTC CA -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 20 do TR SAARB 28/2016..
Lote 27: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE 5 6-CY5/BHQ2 DEN-4 S. Descrição: Sequência: 5 - TYC CTA CYC CTA CGC ATC GCA TTC CG -3 . Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 CY5, 3 Black Hole Quencher 2, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 21 do TR SAARB 28/2016..

PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos para uso laboratorial, tais como: Solução padrão de interferente, padrão analítico de diversos tipos, anticorpos, , etc. Destinados as seções de pesquisa do IEC. Atende TR: SABMI: SAMAM 87, 88, 90/2016; SAPAR: 02/2016

Lote 37: DOSADOR QUIMICO. Anticorpo para marcação de oligodendrócitos não conjugado produzido em coelho: Anti-CNP (****) SIGMA ou similar (FRASCO COM 100 µL) Atende item 2 do TR SAPAR 02/2016..

PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos para laboratório: Água ultrapura, DNA polimerase, padrão analítico de diversos tipos. Destinados as seções de pesquisa do IEC. Atende TR: SAPAR 73/2016, SAMAM 60, 159, 160/2016.

Lote 6: DOSADOR QUIMICO. Oligonucleotídeos: G7 (5 AAGCCCGACGACCTCACCCGCAGTGC 3 ) - Sintetizados em escala inicial de 100 nmol, com rendimento mínimo de 3 O.Ds., dessalinizados, desbloqueados e liofilizados. Purificação padrão Atende item 6 do TR SAPAR 73/2016..
Lote 7: DOSADOR QUIMICO. Oligonucleotídeos G759 (5 GAGGCCGCCCTGGATCTTCGAGACGAC 3 ) - Sintetizados em escala inicial de 100 nmol, com rendimento mínimo de 3 O.Ds., dessalinizados, desbloqueados e liofilizados. Purificação padrão Atende item 7 do TR SAPAR 73/2016..
Lote 8: DOSADOR QUIMICO. Oligonucleotídeos G376 (5 CATAACGACGCCATCGCGGCTCTCAGGAA 3 ) - Sintetizados em escala inicial de 100 nmol, com rendimento mínimo de 3 O.Ds., dessalinizados, desbloqueados e liofilizados. Purificação padrão Atende item 8 do TR SAPAR 73/2016..

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2016 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.