Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Oligonucleotideo |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos de uso laboratorial, tais como: high sensitivity, oligonucleotídeos, testes, kits Elisa, etc.

Lote 3: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Ascaris spp. F, 1 mole Purificação: Standard Desalting Sequência F- 5 GTAATAGCAGTCGGCGGTTTCTT 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação (Item 01 SAPAR 028/2016).
Lote 4: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Ascaris spp. R, 1 mole Purificação: Standard Desalting Sequência R- 5 GCCCAACATGCCACCTATTC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação. (Item 02 SAPAR 028/2016).
Lote 5: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Trichuris trichuria F, 1 mole Purificação: Standard Desalting Sequência F- 5 TCCGAACGGCGGATCA 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação. (Item 03 SAPAR 028/2016).
Lote 6: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Trichuris trichuria R, 1 mole Purificação: Standard Desalting Sequência R - 5 CTCGAGTGTCACGTCGTCCTT 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação. (Item 04 SAPAR 028/2016).
Lote 7: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Strongyloides F, 1 mole Purificação: Standard Desalting Sequência F- 5 GGGCCGGACACTATAAGGAT 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação. (Item 05 SAPAR 028/2016).
Lote 8: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Strongyloides R, 1 mole Purificação: Standard Desalting Sequência R - 5 TGCCTCTGGATATTGCTCAGTTC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação. (Item 06 SAPAR 028/2016).
Lote 9: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, S. mansoni F, 1 mole Purificação: Standard Desalting Sequência F: CCGACCAACCGTTCTATGA, ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 01 SAPAR 029/2016).
Lote 10: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, S. mansoni R, 1 mole Purificação: Standard Desalting Sequência R: CACGCTCTCGCAAATAATCTAAA, ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 02 SAPAR 029/2016).
Lote 11: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, Probe S. mansoni P01, 1 mole Purificação: HPLC Purification Sequência P01: 56-FAMN/TCGTTGTATCTCCGAAACCACTGGACG/3BHQ, ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 03 SAPAR 029/2016).
Lote 12: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, H. sapiens ACTB F, 1 mole Purificação: Standard Desalting Sequência ACTB F: 5 CCATCTACGAGGGGTATGC 3 ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 04 SAPAR 029/2016).
Lote 13: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT H. sapiens ACTB R, 1 mole Purificação: Standard Desalting Sequência ACTB R: 5 GGTGAGGATCTTCATGAGGTA 3 ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 05 SAPAR 029/2016).
Lote 14: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, Probe ACTB P1, 1 mole Purificação: HPLC Purification Sequência ACTB P1: HEX/CCTGCGTCTGGACCTGGCTG/3BHQ ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 06 SAPAR 029/2016).
Lote 15: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, F3 Sm28SrRNA ,1 mole Purificação: Standard Desalting Sequência F3 5 CCTAGTAACTGCGAGTGAAC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação. (Item 07 SAPAR 029/2016).
Lote 16: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, B3 Sm28SrRNA,1 mole Purificação: Standard Desalting Sequência B3 - 5 AAGTATTTAGCCTTGGATGGAG 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 08 SAPAR 029/2016).
Lote 17: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, FIP Sm28SrRNA,1 mole Purificação: Standard Desalting Sequência FIP -5 GCCGTACTCATTGCTGGACTTCGTAAGGCAATGTGGTGT 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 09 SAPAR 029/2016).
Lote 18: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, BIP Sm28SrRNA,1 mole Purificação: Standard Desalting Sequência BIP - 5 GGCAGAGATCAAGTGTGACAGTCTGCATTCACAAACAACCC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 10 SAPAR 029/2016).
Lote 19: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, LoopF Sm28SrRNA,1 mole Purificação: Standard Desalting Sequência LoopF - 5 AGTAATGCCTGAAGCCACC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 11 SAPAR 029/2016).
Lote 20: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, LoopB Sm28SrRNA,1 mole Purificação: Standard Desalting Sequência LoopB - 5 TTTGCTCTGAGCTACCCTTG 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 12 SAPAR 029/2016).
Lote 21: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, 121F, 1 mole Purificação: Standard Desalting Sequência121F 5 GAT CTG AAT CCG ACC AAC CG 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 13 SAPAR 029/2016).
Lote 22: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, 121R, 1 mole Purificação: Standard Desalting Sequência 121R 5 ATA TTA ACG CCC ACG CTC TC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 14 SAPAR 029/2016).
Lote 23: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, Alfa tubF, 1 mole Purificação: Standard Desalting Sequência Alfa tubF 5´ TAT CCA CTT CCC GTT GGC TAC C 3´, ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 15 SAPAR 029/2016).
Lote 24: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, Alfa tubR, 1 mole Purificação: Standard Desalting Sequência Alfa tubR 5´ ACG AGG GTC ACA TTT CAC CAT 3´, ou similar que garanta o mesmo padrão de qualidade e eficiência na reação. (Item 16 SAPAR 029/2016).
Lote 25: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Necator americanus F, 1 mole Purificação: Standard Desalting Sequência F - 5 CTGTTTGTCGAACGGTACTTGC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 17 SAPAR 029/2016).
Lote 26: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Necator americanus R, 1 mole Purificação: Standard Desalting Sequência R - 5 ATAACAGCGTGCACATGTTGC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 18 SAPAR 029/2016).

13/12/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos de uso laboratorial, tais como: oligonucleotídeos, sondas, kits e reagentes.

Lote 1: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR ZIK NS5 ****. Descrição: Sequência: 5 - AAR TAC ACA TAC CAR AAC AAA GTG GT-3 . Escala de síntese: 250 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 01 SAARB 092/2016).
Lote 2: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR ZIK NS5 ****. Descrição: Sequência: 5 - TCC RCT CCC YCT YTG GTC TTG-3 . Escala de síntese: 250 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 02 SAARB 092/2016).
Lote 3: DOSADOR QUIMICO. SONDA TIPO LNA PRIME TIME 5 6-FAM/ZEN/3 IBRFQ, ZIK NS5 **** Descrição: Sequência: 5 - CTY AGA CCA +G+C+T+ GAAR - 3 Escala de síntese: 1 µmol. Modificações: 5 FAM, 3 Iwoa Black FQ , 4 bases de LNA, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas e que seja da mesma marca dos demais itens deste TR Apresentação: 1 (um) tubo fosco contendo oligonucleotídeo liofilizado. (Item 03 SAARB 092/2016).
Lote 4: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR - ZIKAV ENV ****. Descrição: Sequência: 5´-CCGCTGCCCAACACAAG-3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 04 SAARB 092/2016).
Lote 5: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR - ZIKAV ENV ****. Descrição: Sequência: 5´-CCACTAACGTTCTTTTGCAGACAT-3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 05 SAARB 092/2016).
Lote 6: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE - ZIKAV ENV **** Descrição: Sequência: 5´-6FAM- AGCCTACCT/ZEN/TGACAAGCAGTCAGACACTCAA-IwBkFQ-3´. Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 6-FAM, Int ZEN, 3 Iowa Black FQ, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 06 SAARB 092/2016).
Lote 7: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR VDEN **** F. Descrição: Sequência: 5´- GGTTAGAGGAGACCCCTCCC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 07 SAARB 092/2016).
Lote 8: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR - VDEN **** R. Descrição: Sequência: 5´- GAGACAGCAGGATCTCTGGTCT -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 08 SAARB 092/2016).
Lote 9: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE - VDEN GEN probe Descrição: Sequência: 5´-6FAM- AAACAGCATATTGACGCTGGGA/3BHQ_2/-3´. Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 6-FAM, Int ZEN, 3 Iowa Black FQ, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 09 SAARB 092/2016).
Lote 10: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR RNASE P F. Descrição: Sequência: 5 - AGA TTT GGA CCT GCG AGC G -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 10 SAARB 092/2016).
Lote 11: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR RNASE P R. Descrição: Sequência: 5 - GAG CGG CTG TCT CCA CAA GT -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 11 SAARB 092/2016).
Lote 12: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE 5 6-HEX/ZEN/3 IBRFQ RNASE P S Descrição: Sequência: 5 - TTC TGA CCT GAA GGC TCT GCG CG -3 . Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 HEX, Int ZEN, 3 Iowa Black FQ, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas e que seja da mesma merca dos itens 5 a 22 deste TR Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 12 SAARB 092/2016).
Lote 13: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador Ph-M-2FM . Sequência: 5´- GGVMTSMTHAATTAYCAGTGYCA -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 01 SAARB 094/2016).
Lote 14: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador Ph-M-3RM. Sequência: 5´- CAYCTYCKNGARCTNARRCA -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 02 SAARB 094/2016).
Lote 15: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador PHLV- END . Sequência: 5´- GGGGGGGGGGACACAAAG -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 03 SAARB 094/2016).
Lote 16: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador PH-S-DR-RVF . Sequência: 5´- AAAGCTGGGGTGCATCAT -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 04 SAARB 094/2016).
Lote 17: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador BUN-S. Sequência: 5´- AGTAGTGTGCTCCAC-3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 05 SAARB 094/2016).
Lote 18: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador BUN-C. Sequência: 5´- AGTAGTATACTCCAC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 06 SAARB 094/2016).
Lote 19: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador BS-S256. Sequência: 5´- GTGGGGTCCAATTTGC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 07 SAARB 094/2016).
Lote 20: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador BS-C256. Sequência: 5´- TGAACCCTATGCATCT -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado.Oligonucleotídeo sintético personalizado iniciador BS-C256. Sequência: 5´- TGAACCCTATGCATCT -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 08 SAARB 094/2016).
Lote 21: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador NPhlebo1 (S). Sequência: 5´- ATGGARGGITTTGTIWSICIICC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 09 SAARB 094/2016).
Lote 22: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador NPhlebo1 (NS). Sequência: 5´- AARTTRCTIGWIGCYTTIARIGTIGC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 10 SAARB 094/2016).
Lote 23: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador NPhlebo2 (S). Sequência: 5´- WTICCIAAICCIYMSAARATG -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 11 SAARB 094/2016).
Lote 24: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador NPhlebo2 (NS). Sequência: 5´- TCYTCYTTRTTYTTRARRTARCC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 12 SAARB 094/2016).
Lote 2: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR ZIK NS5 ****. Descrição: Sequência: 5 - TCC RCT CCC YCT YTG GTC TTG-3 . Escala de síntese: 250 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 02 SAARB 092/2016).

12/12/2016 - GO ( GOIÂNIA ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/SECRETARIA DE DEFESA AGROPECUÁRIA/COORDENAÇÃO GERAL DE APOIO LABORATORIAL/LABORATÓRIO NACIONAL AGROPECUÁRIO - LANAGRO/GO (UASG: 130032)

Aquisição de insumos para biologia molecular

Lote 2: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO PARA SEQUENCIAMENTO AUTOMÁTICO, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA **** PMOL.

02/12/2016 - PR ( CURITIBA ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE FEDERAL DO PARANÁ/PRÓ-REITORIA DE ADMINISTRAÇÃO/DEPARTAMENTO DE SERVIÇOS GERAIS/HOSPITAL DE CLÍNICAS (UASG: 153808)

Implantação de Sistema Registro de Preços, com vigência de doze meses, para aquisição parcelada, conforme necessidade, de insumos laboratoriais, (agar fenil etílico e outros). O objeto atenderá o Hospital de Clínicas da UFPR, conforme especificações detalhadas contidas em edital e anexos.

Lote 40: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, ESCALA ESCALA 5 NMOL.
Lote 41: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, ESCALA ESCALA 5 NMOL.
Lote 46: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 25 NMOL.
Lote 47: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 25 NMOL.

01/12/2016 - SP ( SAO PAULO ): INSTITUTO ADOLFO LUTZ

MATERIAL DE CONSUMO

Lote 4: OLIGONUCLEOTIDEOS, PROBE; COM 31 BASES MARCADA COM DIGOXIGENINA NA POSICAO 3', PURIFICADO POR HPLC; CONCENTRACOA MINIMA DE 200 NANOMOLES, PO LIOFILIZADO COM SEQUENCIA DE NUCLEOTIDEOS VARIADA, COM CERTIFICADO DE ANALISE, VALIDADE MINIMA DE 01(UM) ANO A CONTAR DA DATA DE ENTREGA NO ALMOXARIFADO, ACONDICIONADO EM FRASCO APROPRIADO, ROTULO COM NR. DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO, PROCEDENCIA E EMBALAGEM APROPRIADA P/ PRODUTO
Lote 5: OLIGONUCLEOTIDEOS, PROBE; COM 60 BASES MARCADA COM DIGOXIGENINA NA POSICAO 3', PURIFICADO POR HPLC; CONCENTRACAO MINIMA DE 200 NANOMOLES, PO LIOFILIZADO COM SEQUENCIA DE NUCLEOTIDEOS VARIADA, COM CERTIFICADO DE ANALISE, VALIDADE MINIMA DE 01(UM) ANO A CONTAR DA DATA DE ENTREGA NO ALMOXARIFADO, ACONDICIONADO EM FRASCO APROPRIADO, ROTULO COM NR. DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO, PROCEDENCIA E EMBALAGEM APROPRIADA P/ PRODUTO

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.