Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Purification |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de pipetas, kit de purificação, reagentes, anti-human, etc.

Lote 1: DOSADOR QUIMICO. Kit Purificação de DNA, Illustra GFX PCR DNA and Gel Band Purification Kit - kit para purificar DNA . Contém colunas GFX, tubos de coleta, tampões codificados por cores, tampão de lavagem e dois tampões de eluição (Tris-HCl e de água esterilizada). Rende até 250 purificações. (Item 04 SAARB 040/2016).
Lote 30: DOSADOR QUIMICO. Amicon® Pro Purification System with 3kDa Amicon® Ultra-0.5 Device- filtro de 0,5 para proteínas acima de 3 Kda . Tubos de suporte claros e tampa rosa com comprimento de 12cm (4,7 pol.), diâmetro de 2,97 cm, área de filtração de 1 cm2, volume de 10 mL e volume final de concentrado mínimo de 15µL. Celulose regenerada. Caixa com 24 unidades com filtros de 3 kda com volume total de 10 mL. (Item 14 SAARB 041/2016).
Lote 31: DOSADOR QUIMICO. Amicon® Pro Purification System with 10kDa Amicon® Ultra-0.5 Device- filtro 0,5 para proteínas acima de 10Kda . Tubos de suporte claros e tampa rosa com comprimento de 12cm (4,7 pol.), diâmetro de 2,97 cm, área de filtração de 1 cm2, volume de 10 mL e volume final de concentrado mínimo de 15µL. Celulose regenerada. Caixa com 24 unidades com filtros de 10 kda com volume total de 10 mL. (Item 15 SAARB 041/2016).
Lote 32: DOSADOR QUIMICO. Amicon® Pro Purification System with 30kDa Amicon® Ultra-0.5 - filtro 0,5 para proteínas acima de 30 Kda. Tubos de suporte claros e tampa rosa com comprimento de 12cm (4,7 pol.), diâmetro de 2,97 cm, área de filtração de 1 cm2, volume de 10 mL e volume final de concentrado mínimo de 15µL. Celulose regenerada. Caixa com 24 unidades com filtros de 30 kda com volume total de 10 mL.(Item 16 SAARB 041/2016).
Lote 33: DOSADOR QUIMICO. Amicon® Pro Purification System with 50kDa Amicon® Ultra-0.5 Device- filtro 0,5 para proteínas acima de 50 Kda . Tubos de suporte claros e tampa rosa com comprimento de 12cm (4,7 pol.), diâmetro de 2,97 cm, área de filtração de 1 cm2, volume de 10 mL e volume final de concentrado mínimo de 15µL. Celulose regenerada. Caixa com 24 unidades com filtros de 50 kda com volume total de 10 mL. (Item 17 SAARB 041/2016).
Lote 34: DOSADOR QUIMICO. Amicon® Pro Purification System with 100kDa Amicon® Ultra-0.50 -filtro de 0,5 para proteínas acima de 100 Kda . Tubos de suporte claros e tampa rosa com comprimento de 12cm (4,7 pol.), diâmetro de 2,97 cm, área de filtração de 1 cm2, volume de 10 mL e volume final de concentrado mínimo de 15µL. Celulose regenerada. Caixa com 24 unidades com filtros de 100 kda com volume total de 10 mL. (Item 18 SAARB 041/2016).

RJ ( RIO DE JANEIRO ): MINISTÉRIO DA SAÚDE/FUNDAÇÃO OSWALDO CRUZ/ESCOLA NACIONAL DE SAÚDE PÚBLICA SÉRGIO AROUCA (UASG: 254450)

Aquisição de reagentes.

Lote 32: ANALISADOR - PEÇA/COMPONENTE. ILLustra GFX PCR DNA and Gel Band Purification Kit. Kit Para isolamento, purificação e concentração de fragmentos (50 bp a 10 kb) de PCR (kit para 250 reações). Flexível, com volume de eluição de 10 a 50 l para diferentes concentrações desejadas utilizando colunas de purificação. O kit deve combinar um tampão caotrópico versátil com uma matriz de fibra de vidro com suporte em uma-coluna para a purificação de DNA de ambas as soluções e gel de agarose. Recuperações típicas de 60 a 80% para os fragmentos de DNA de gel de agarose e no mínímo 95% para produtos de PCR. Remoção de contaminantes igual ou superior a 99,5%. MARCA: GE..

DF ( BRASÍLIA ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/DEPARTAMENTO DE ADMINISTRAÇÃO DE MATERIAIS E SERVIÇOS (UASG: 135038)

Aquisição de Materiais e Reagentes para Laboratórios da Embrapa Recursos Genéticos e Biotecnologia

Lote 49: REAGENTE PARA TINTA. KIT DE PURIFICAÇÃO DE ÁCIDO NUCLEICO (NUCLEIC ACID PURIFICATION KIT) NUCLEOBOND® XTRA MIDI PLUS - 50 REAÇÕES. MACHEREY-NAGEL CÓD: **** (CONFORME JUSTIFICATIVA TECNICA ANEXA AO PROCESSO).

PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos de uso laboratorial, tais como: high sensitivity, oligonucleotídeos, testes, kits ELISA, etc.

Lote 11: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, Probe S. mansoni P01, 1 mole Purificação: HPLC Purification Sequência P01: 56-FAMN/TCGTTGTATCTCCGAAACCACTGGACG/3BHQ, ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 03 SAPAR 029/2016).
Lote 14: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, Probe ACTB P1, 1 mole Purificação: HPLC Purification Sequência ACTB P1: HEX/CCTGCGTCTGGACCTGGCTG/3BHQ ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 06 SAPAR 029/2016).

CE ( SOBRAL ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/EMBRAPA/CNPC (UASG: 135010)

Aquisição de reagente e material de laboratório para a Embrapa Caprinos e Ovinos

Lote 32: PEÇAS E ACESSÓRIOS PURIFICADOR ÁGUA. PEÇAS E ACESSÓRIOS PURIFICADOR ÁGUA - PEÇAS E ACESSÓRIOS PURIFICADOR ÁGUA, TIPO CARTUCHO Q GARD 01 Milli-Q Purification, REFERÊNCIA QGARD00R1, APLICAÇÃO PURIFICADOR MILLIPORE.

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2016 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.