Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599

(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |

Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |

O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Purification |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.


Registro de Preços para aquisição de peças sobressalentes e acessórios originais/genuínas para manutenção dos cloradores de fabricação Serve Trente Water Purification, INC, instalados na Estação de Tratamento de Água ETA RDE 001 da Caesb.

Lote 1: PEÇAS/ACESSÓRIOS BOMBA DOSADORA / HIDRÁULICA. Registro de Preços para aquisição de peças sobressalentes e acessórios originais/genuínas para manutenção dos cloradores de fabricação Serve Trente Water Purification, INC, instalados na Estação de Tratamento de Água ETA RDE 001 da Caesb..


Aquisição de insumos de uso laboratorial, tais como: high sensitivity, oligonucleotídeos, testes, kits Elisa, etc.

Lote 11: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, Probe S. mansoni P01, 1 mole Purificação: HPLC Purification Sequência P01: 56-FAMN/TCGTTGTATCTCCGAAACCACTGGACG/3BHQ, ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 03 SAPAR 029/2016).
Lote 14: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, Probe ACTB P1, 1 mole Purificação: HPLC Purification Sequência ACTB P1: HEX/CCTGCGTCTGGACCTGGCTG/3BHQ ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 06 SAPAR 029/2016).


Aquisição de insumos laboratoriais, tais como: Kits, reagentes, testes, enzimas, etc. Destinados as seções de pesquisa do IEC. Atende TR: SAPAT 32/2016; SAPAR 10, 31, 52/2016; SABMI 02/2016; SAMAM 166/2016

Lote 28: DOSADOR QUIMICO. Kit para purificação de DNA Wizard Genomic DNA purification Kit . Designado para isolar o DNA de diversos tipos de amostras biológicas, entre eles células de sangue e tecidos. Cada Kit contém reagentes para isolar o DNA genômico e inclui, entre outros: solução de lise celular, solução de lise nucléica, solução de precipitação protéica, solução de reidratação do DNA e solução de RNAse A. Kit contendo 500 reações. Kit Wizard Genomic DNA purification Kit ou produto similar que ssegure os mesmos padrões acima referidos. Atende item 3 do TR SAPAR 31/2016..


Aquisição de pipetas, kit de purificação, reagentes, anti-human, etc.

Lote 1: DOSADOR QUIMICO. Kit Purificação de DNA, Illustra GFX PCR DNA and Gel Band Purification Kit - kit para purificar DNA . Contém colunas GFX, tubos de coleta, tampões codificados por cores, tampão de lavagem e dois tampões de eluição (Tris-HCl e de água esterilizada). Rende até 250 purificações. (Item 04 SAARB 040/2016).
Lote 30: DOSADOR QUIMICO. Amicon® Pro Purification System with 3kDa Amicon® Ultra-0.5 Device- filtro de 0,5 para proteínas acima de 3 Kda . Tubos de suporte claros e tampa rosa com comprimento de 12cm (4,7 pol.), diâmetro de 2,97 cm, área de filtração de 1 cm2, volume de 10 mL e volume final de concentrado mínimo de 15µL. Celulose regenerada. Caixa com 24 unidades com filtros de 3 kda com volume total de 10 mL. (Item 14 SAARB 041/2016).
Lote 31: DOSADOR QUIMICO. Amicon® Pro Purification System with 10kDa Amicon® Ultra-0.5 Device- filtro 0,5 para proteínas acima de 10Kda . Tubos de suporte claros e tampa rosa com comprimento de 12cm (4,7 pol.), diâmetro de 2,97 cm, área de filtração de 1 cm2, volume de 10 mL e volume final de concentrado mínimo de 15µL. Celulose regenerada. Caixa com 24 unidades com filtros de 10 kda com volume total de 10 mL. (Item 15 SAARB 041/2016).
Lote 32: DOSADOR QUIMICO. Amicon® Pro Purification System with 30kDa Amicon® Ultra-0.5 - filtro 0,5 para proteínas acima de 30 Kda. Tubos de suporte claros e tampa rosa com comprimento de 12cm (4,7 pol.), diâmetro de 2,97 cm, área de filtração de 1 cm2, volume de 10 mL e volume final de concentrado mínimo de 15µL. Celulose regenerada. Caixa com 24 unidades com filtros de 30 kda com volume total de 10 mL.(Item 16 SAARB 041/2016).
Lote 33: DOSADOR QUIMICO. Amicon® Pro Purification System with 50kDa Amicon® Ultra-0.5 Device- filtro 0,5 para proteínas acima de 50 Kda . Tubos de suporte claros e tampa rosa com comprimento de 12cm (4,7 pol.), diâmetro de 2,97 cm, área de filtração de 1 cm2, volume de 10 mL e volume final de concentrado mínimo de 15µL. Celulose regenerada. Caixa com 24 unidades com filtros de 50 kda com volume total de 10 mL. (Item 17 SAARB 041/2016).
Lote 34: DOSADOR QUIMICO. Amicon® Pro Purification System with 100kDa Amicon® Ultra-0.50 -filtro de 0,5 para proteínas acima de 100 Kda . Tubos de suporte claros e tampa rosa com comprimento de 12cm (4,7 pol.), diâmetro de 2,97 cm, área de filtração de 1 cm2, volume de 10 mL e volume final de concentrado mínimo de 15µL. Celulose regenerada. Caixa com 24 unidades com filtros de 100 kda com volume total de 10 mL. (Item 18 SAARB 041/2016).


Aquisição de reagentes.

Lote 32: ANALISADOR - PEÇA/COMPONENTE. ILLustra GFX PCR DNA and Gel Band Purification Kit. Kit Para isolamento, purificação e concentração de fragmentos (50 bp a 10 kb) de PCR (kit para 250 reações). Flexível, com volume de eluição de 10 a 50 l para diferentes concentrações desejadas utilizando colunas de purificação. O kit deve combinar um tampão caotrópico versátil com uma matriz de fibra de vidro com suporte em uma-coluna para a purificação de DNA de ambas as soluções e gel de agarose. Recuperações típicas de 60 a 80% para os fragmentos de DNA de gel de agarose e no mínímo 95% para produtos de PCR. Remoção de contaminantes igual ou superior a 99,5%. MARCA: GE..

Assista ao Vídeo |

O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!

Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.