Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Sigma |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

RS ( ALEGRETE ): MINISTÉRIO DA DEFESA/COMANDO DO EXÉRCITO/COMANDO MILITAR DO SUL/3ªDIVISÃO DE EXÉRCITO/2ªBRIGADA DE CAVALARIA MECANIZADA/10ºBATALHÃO LOGÍSTICO (UASG: 160354)

Registro de preço para eventual aquisição de baterias automotivas, câmaras de ar, protetores de câmaras de ar e óleos lubrificantes, conforme condições, quantidades, exigências e estimativas, inclusive as encaminhadas por possíveis órgãos e entidades participantes, estabelecidas no instrumento convocatório.

Lote 63: ÓLEO LUBRIFICANTE. SAE 5W30 API SM e ILSAC GF-4 ou 5 (Base 100% sintética ou semissintética) ou superior. Aplicações: Óleo para uso em motores de quatro tempos Flex, a gasolina, a etanol e GNV (multiválvulas com injeção eletrônica) e diesel de comerciais leves, automóveis, SUV e Pick-up gasolina ou diesel onde o fabricante recomende um lubrificante de especificação ACEA A3/B4, A3/B3, API SN/CF SAE 5W30. Exemplos motores Ford (Duratec, Zetec, Zetec Rocam e Sigma). Podendo ser também utilizado em veículos que requeiram lubrificantes **** como HONDA, TOYOTA e demais fabricantes. Nível de desempenho: API SM e ILSAC GF-4 ou superior. Aprovações Exigidas: dexos 1®, GM-LL-A-025, ****, ****, FORD ****, e Chrysler ****, ****..

RJ ( RIO DE JANEIRO ): PODER JUDICIÁRIO/TRIBUNAL SUPERIOR ELEITORAL/TRIBUNAL REGIONAL ELEITORAL DO RIO DE JANEIRO (UASG: 70017)

Aquisição de material hidráulico.

Lote 9: VÁLVULA. Válvula de escoamento de 1¼ em metal com ladrão para lavatório, acabamento cromado, com anel de vedação de borracha e flange de fixação também em metal, acompanhado de tampão plástico. Referência: Esteves e Sigma. DEMAIS ESPECIFICAÇÕES, OBRIGAÇÕES E RESPONSABILIDADES CONTIDAS NO TERMO DE REFERÊNCIA - ANEXO I DO EDITAL..

DF: MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/DEPARTAMENTO DE ADMINISTRAÇÃO DE MATERIAIS E SERVIÇOS (UASG: 135038)

Aquisição de Reagentes para Laboratório

Lote 4: Cloreto de Cobalto Hexahidratado testado em cultura celular, Sigma, Cód: **** (Conforme Justificativa Técnica Anexa ao Processo)

PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de materiais para uso laboratorial, tais como: lugol, formaldeído, álcool, acido, tubos, ponteiras, luvas, gaze, criobox, fosfatos, microtubos, reservatórios, etc. (SBC SAPAR 26, 33, 41, 44, 66, 69, 80/2016; SBC SAARB 18/16; SBC SAVIR 61, 77/2016 e SBC SAMAM 131/2016).

Lote 4: DOSADOR QUIMICO. EDTA (Ácido Etilenodiamino Tetra-acético) ****, Sigma. UNIDADE. ITEM 04 DO SBC nº 26/2016- SAPAR.

21/12/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos laboratoriais, tais como: Kits, reagentes, testes, enzimas, etc. Destinados as seções de pesquisa do IEC. Atende TR: SAPAT 32/2016; SAPAR 10, 31, 52/2016; SABMI 02/2016; SAMAM 166/2016

Lote 38: DOSADOR QUIMICO. Iniciadores SSUr - Marca: Sigma R221: 5 -GGTTCCTTTCCTGATTTACG-3 R332: 5 -GGC CGGTAAAGGCCGAATAG-3 Fabricar na escala de síntese de 25nMols cada primer Atende item 9 do TR SAPAR 52/2016..
Lote 39: DOSADOR QUIMICO. Iniciadores SSUr - Marca: Sigma R223: 5 -TCC CAT CGC AAC CTC GGT T-3 R333: 5 -AAA GCG GGC GCG GTG CTG-3 Fabricar na escala de síntese de 25nMols cada primer Atende item 10 do TR SAPAR 52/2016..
Lote 40: DOSADOR QUIMICO. Iniciadores K26 (haspb)- Marca: Sigma K26f : 5 -ACGAAGGACTCCGCAAAG-3 K26r: 5 -TTCCCATCGTTTTGCTG-3 Fabricar na escala de síntese de 25nMols cada primer Atende item 11 do TR SAPAR 52/2016..
Lote 41: DOSADOR QUIMICO. Iniciadores Citocromo b Marca: Sigma Cytb Vert1: 5 CCCCTCAGAATGATATTTGTCCTCA 3 Cytb Vert2: 5 GCHGAYACHWVHHYHGCHTTYTCHTC 3 Atende item 12 do TR SAPAR 52/2016..
Lote 42: DOSADOR QUIMICO. Iniciadores SSUr Marca: Sigma Lu.18SrRNA-1S: 5 TGCCAGTAGTTATATGCTTG 3 Lu.18SrRNA-1R: 5 TTACGCGCCTGCTGCCTTCC 3 Atende item 13 do TR SAPAR 52/2016..
Lote 43: DOSADOR QUIMICO. Iniciadores Citocromo b Marca: Sigma Cyt b Forwrad: 5 CGAAGCTTGATATGAAAAACCATCGTTG 3 Cyt b Reverse: 5 TGTAGTTRTCWGGGTCHCCTA 3 Atende item 14 do TR SAPAR 52/2016..

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.