Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Taa |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

PA: MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de bases nucleotídicas para primers.

Lote 1: Bases nucleotídicas para confecção de "PRIMERs", escala 50 mMol. PicoB25 I F:TGG TGT GGA TGT TTC/ PicoB43I R:ART GYT GGT CGA ACT T; PicoB23 II F:CGG TAT GGA TGT TTC/ PicoB24 II R:AAG CGA GCC CAT GTA; HBoV 01.2 F:TATGGCCAAGGCAATCGTCCA AG/ HBoV 02.2 R: GCCGCGTGAACATGAG AAACAGA; REOL3 F:CAG TCG ACA CAT TTG TGG TC/ REOL3 R: GCG TAC TGA CGT GGA TCA TA; VP2Fc (GEN_VP2Fc):GGC TAT TAA AGG YTC AAT GGC GTA CAG/ VP2Rbc (GEN_VP2Rbc):GTC ATA TCT CCA CAR TGG TGG GGT; VP3-24F (GEN_VP3_24F):TGY GTT TTA CCT CTG ATG GTG/ **** (****):TGA CYA GTG TGT TAA GTT TYT AGC; 5 (****):ATG AAA TAT GCT GGC TCG C/ 317 (****):ACA ACA ATG TTC TCC TSR TCA C/ L-VP4-P6 (****):GGT CAC ATC CTC TAT AGA GCT CT/ 137 (****):TGT AGA ATT ARY TGT TCA ATT CTA TTC; L-VP6F (GEN_VP6F):GGC TTT WAA ACG AAG TCT TC -/ L-VP6R (GEN_VP6R):GGT CAC ATC CTC TCA CT; L-NSP2F (GEN_NSP2F):GGC TTT TAA AGC GTC TCA G/ L-NSP2Rb (GEN_NSP2Rb):GGT CAC ATA AGC GCT TTC RAT TC (...) OBS: SOLICITAR ESPECIFICAÇÕES COMPLETAS PELO E-MAIL ***@***.*.* ANTES DE DAR LANCE NO SISTEMA. PRAZO DE VALIDADE MÍNIMA 12 MESES.(ATENDE ITEM ÚNICO DO SBC NEP 06/2016)

DF ( BRASÍLIA ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/DEPARTAMENTO DE ADMINISTRAÇÃO DE MATERIAIS E SERVIÇOS (UASG: 135038)

Aquisição de Materiais e Reagentes para Laboratórios da Embrapa Recursos Genéticos e Biotecnologia

Lote 48: FITA ADESIVA VIDRARIA. GRADE EM COBRE REVESTIDA COM FILME DE CARBONO FORMVAR PACOTE COM 100 (COPPER GRID- FORMVAR/CARBON SUPPOT FILM) 200MESH. CÓD. **** PELCO/TED PELLA OU TAAB F077/100.

PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de materiais de uso laboratorial, tais como Bromophenol, anticorpos secundários, microarrays, oligos, sondas, kits reagentes e etc., destinado a atender as Seções do IEC, SAPAR 86/2016; SAMAM 157/2016; SAHEP 40/2016; SABMI 32/2016; SAARB 28, 80/2016

Lote 25: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR DEN-4 F. Sequência: 5 - TTG TCC TAA TGA TGC TRG TCG -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. Atende item 19 do TR SAARB 28/2016..

RJ ( SEROPÉDICA ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE FEDERAL RURAL DO RIO DE JANEIRO/DECANATO DE ASSUNTOS ADMINISTRATIVOS/DEPARTAMENTO DE MATERIAL E SERVIÇOS AUXILIARES (UASG: 153166)

Aquisição de materiais químicos

Lote 193: SOLVENTE. Tioacetamida (taa), aspecto físico cristal incolor à esbranquiçado, fórmula química c2h5ns, peso molecular 75,13, grau de pureza pureza mínima de 99, característica adicional reagente p.a. Acs, número de referência química cas ****.

27/10/2016 - MG ( PEDRO LEOPOLDO ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/SECRETARIA DE DEFESA AGROPECUÁRIA/COORDENAÇÃO GERAL DE APOIO LABORATORIAL/LABORATÓRIO NACIONAL AGROPECUÁRIO - LANAGRO/MG/UNIDADE EM PEDRO LEOPOLDO (UASG: 130058)

Aquisição de insumos Laboratoriais, em proveito do LANAGRO/MG.

Lote 23: MEDIDOR LABORATÓRIO. Enzima de restrição VspI, com sítio de restrição 5-ATTAAT-3 3-TAATTA-5. Conteúdo detalhado do kit: kit com a enzima na concentração de 10 U/microlitro e tampão de reação em que enzima apresente atividade relativa de 100 por cento. Kit com **** unidades da enzima VspI e tampão da reação de digestão apropriado. Embalagem com 1 kit(s). Prazo de validade de no mínimo 9 meses após a data de entrega no laboratório..

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2016 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.