Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Tamra |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

SP: SEC. SAÚDE/HOSP. DAS CLÍNICAS DA FAC.DE MED.DA USP/HC.DA FACULDADE DE MEDICINA DA UNIV.S.PAULO

reagentes e insumos para uso laboratorial/EQUIPAMENTOS E ARTIGOS DE USO MEDICO, ODONTOLOGICO, HOSPITALAR E LABORATORIAL/INSUMOS DE EQUIPAMENTOS DE USO LABORATORIAL

Lote 1: KIT DE CALIBRAÇAO QUE CONTEM 9 (NOVE) PLACAS ÓPTICAS DE 96 WELLS, COMPATÍVEIS COM SISTEMA ABI **** LIFETECH, COM VOLUME MÍNIMO DE 50 UL CADA WELL. O PRODUTO DE UMA CALIBRAÇAO REPRESENTA A FLUORESCÊNCIA DE CADA FILTRO. CADA PERFIL CONSISTE EM UM JOGO DE 96 LINHAS QUE CORRESPONDEM À FLUORESCÊNCIA RECOLHIDO DOS 96 POÇOS DA PLACA DE CALIBRAÇAO CONTENTO OS CORANTES ESPECÍFICOS (BACKGROUND, FAM, JOE, NED, ROX, ROI, SYBR GREEN, TAMRA E VIC). REAGENTE DEVE ESTAR AUSENTE DE PARTÍCULAS INFECTANTES OU CONTAMINANTES. DEVERÁ PERMANECER ESTÁVEL POR PERÍODO IGUAL OU SUPERIOR A 01 (UM) ANO ARMAZENADO A TEMPERATURA DE -15 A -25ºC. O TRANSPORTE E ARMAZENAMENTO DEVEM SER INFORMADOS PELO FABRICANTE E CONSTAR DATA DE FABRICAÇAO, LOTE E VALIDADE. ****

23/11/2016 - RJ ( RIO DE JANEIRO ): MINISTÉRIO DA SAÚDE/FUNDAÇÃO OSWALDO CRUZ/INSTITUTO DE PESQUISA CLINICA EVANDRO CHAGAS (UASG: 254438)

Aquisição de Reagentes Laboratorial

Lote 68: MEDIDOR LABORATÓRIO. SONDA TAQMAN NA CONCENTRAÇÃO MÍNIMA DE **** PMOLES 16 MARCADA COM 5´-FAM E 3´-TAMRA, SONDA SK45.SEQÜÊNCIA: 5´-ACGCCCTACTGGCCACCTGTC-3´, MARCA SIGMA-ALDRICH.

16/11/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos de uso laboratorial, tais como: vidraria, marcador de peso molecular, ácido acético, anticorpos, kit qualitativo, DNA controle, bases nucleotídicas.

Lote 32: DOSADOR QUIMICO. Sonda TaqMan. Marcada com fluorescência em 5 com molécula repórter 6-carboxyfluorescein (FAM) e na 3 com quencher 6-carboxy-tetramethyl-rhodamine (TAMRA). Purificação por HPLC. Concentração 250 nmoles. 01 (um) frasco de cada oligonucleotídeo de acordo com a sequência VRSA pr 5 FAM - CACCATCCAACGGAGCACAGGAGAT-3 TAMRA (Item 02 SAVIR 058/2016).
Lote 33: DOSADOR QUIMICO. Sonda TaqMan. Marcada com fluorescência em 5 com molécula repórter 6-carboxyfluorescein (FAM) e na 3 com quencher 6-carboxy-tetramethyl-rhodamine (TAMRA). Purificação por HPLC. Concentração 250 nmoles. 01 (um) frasco de cada oligonucleotídeo de acordo com a sequência VRSB pr 5 FAM - TTCCCTTCCTAACCTGGACATAGCATATAACATACCT-3 TAMRA (Item 03 SAVIR 058/2016).

09/11/2016 - DF ( BRASÍLIA ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/EMBRAPA/CAFÉ (UASG: 135097)

Aquisição de Material de Laboratório.

Lote 1: HASTE PADRÃO CALIBRAÇÃO. **** Fast Real-Time PCR Systems Spectral Calibration Kit I-Descrição: Kit de calibração para equipamentos de RT-qPCR (**** fast), contendo 9 placas óticas de 96 poços ´96-Well Fast Thermocycling Plates´ carregadas e seladas, sendo: uma placa carregada e selada com o background, uma placa selada e carregada com o (ROI) ´Region of Interest´, e outras sete placas carregadas e seladas com os fluoróforos equivalente ou de melhor qualidade que o produto/marca: TAMRA, VIC, ROX, JOE, SYBR Green, FAM e NED. CAT: ****;.
Lote 30: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Kit de Calibração espectral do Sistema de Real Time PCR **** (**** Real Time PCR System Spectral Calibration Kit I), kit que estabelece valores espectrais e multicomponentes para sondas FAM/SUBR Green I, VIC/JOE, e NED/TAMRA/ROX para o sistema de Real Time PCR **** da Applied Biosystem. Número catalogo ****.

08/11/2016 - RS ( BENTO GONÇALVES ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/EMBRAPA/CNPUV (UASG: 135033)

Contratação de empresa para fornecimento de reagentes e materiais laboratoriais para a Embrapa Uva e Vinho.

Lote 47: REAGENTE PARA TINTA. Conjunto de iniciadores e respectiva sonda de RT-PCR. Reagentes necessários para o diagnóstico de vírus por RT-PCR em tempo real **** CGTTCCTGGTCGCAGAA 25 nmol, **** GCGAAGATGGACTCCAGTA 25 nmol, **** 5´-FAM CAGACCCCTTCATGGAAAGACAGG 5´TAMRA 5 nmol. Escala de síntese dos iniciadores: 25 nmol Escala de síntese da sonda: 5nmol..

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.