Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Tubo Tca |

Atualizado em 15/11/2016. Acesse também licitações mais recentes e baixe os editais.

26/10/2016 - SP ( CAMPINAS ): UNICAMP/HOSPITAL DE CLINICAS

MATERIAL DE USO LABORATORIAL

Lote 1: REAGENTES E INSUMOS PARA TESTES DE COAGULACAO, KIT PARA TESTE DE COAGULACAO ATIVADA - TCA, TUBO COM CELITE CONTENDO HASTE CENTRAL, BASTAO DETECTOR E ATIVADOR DE COAGULACAO SECO, COM DEMARCACAO DE 2 ML DE SANGUE, EXECUCAO : COMPATIVEL COM MONITOR DE COAGULACAO ATIVADA MAC ****, VALIDADE MINIMA APOS A ENTREGA DE 12 MESES, ACONDICIONADO EM MATERIAL APROPRIADO QUE GARANTA A INTEGRIDADE DO PRODUTO, A APRESENTACAO DO PRODUTO DEVERA OBEDECER A LEGISLACAO VIGENTE

18/10/2016 - DF ( BRASÍLIA ): GOVERNO DO DISTRITO FEDERAL - GDF/SOCIEDADE DE TRANSPORTES COLETIVOS DE BRASÍLIA LTDA - TCB (UASG: 926167)

Contratação de empresa para fornecimento de peças de motor (engrenagem, flexível de lubrificação, serpentina do compressor, válvula de retenção, anéis, juntas, carcaça de distribuição, turbinas, bronzinas, compressores, bico injetor, reparo do cabeçote, kit do motor, porta injetor, caneta do bico, refrigerador de óleo, cárter de óleo, jogo de junta, motor compacto parcial, tubo guia da vareta do nível de óleo, turbo alimentador e parafuso central da polia), para atender a frota de ônibus da TCB Sociedade de

Lote 32: PEÇA MECÂNICA/ELÉTRICA - VEÍCULO AUTOMOTIVO. PEÇA MECÂNICA/ELÉTRICA - VEÍCULO AUTOMOTIVO, NOME PECA MECANICA / ELETRICA - TUBO ALIMENTADOR PARA MOTOR MWM X-10 C/ INTERCOOLER 6.10 TCA REF.2RJ/ ****, GARETT- **** TO4E, LACON PN **** MOD. S2EL 210 OU SIMILAR..

05/10/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de materiais de uso laboratorial, tais como: testes, oligonucleotídeos, superscript, kits, reagentes, etc.

Lote 5: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores EVP2F-P2 5 GTR CCR CCH ACA GTT GAR TCA 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 03 SAVIR 030/2016).
Lote 13: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores JV13I - 5 TCA TCA TCA CCA TAG AAI GAG 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 02 SAVIR 031/2016).
Lote 21: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores P270 - 5 TCAGATGCATTGTCATTGGT 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 10 SAVIR 031/2016).

21/09/2016 - MG ( JUIZ DE FORA ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/CENTRO NACIONAL DE PESQUISA DE GADO DE LEITE (UASG: 135015)

Aquisição de material de construção e ferramentas, conforme descrição e local de entrega constantes do Anexo I do Edital.

Lote 68: TÊ - CONEXÃO PARA TUBOS E CANOS - SOLDÁVEL. TCAP PVC rosqueável 1.

21/09/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de materiais de uso laboratorial, tais como: sínteses, penicilina, oligonucleotídeos, primers, etc, destinados a diversas seções do IEC.

Lote 58: DOSADOR QUIMICO. Primer 2E2F1 Forward In (2) para o Diagnóstico de Malária Humana: 5´ CGA AAC TCA AGC ACA TGT AGA 3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 07 SAPAR 062/2016).

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.