Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Iniciadores |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

PA ( BELÉM ): MINISTÉRIO DA DEFESA/COMANDO DO EXÉRCITO/COMANDO MILITAR DA AMAZÔNIA/8ª REGIÃO MILITAR/HOSPITAL GERAL DE BELÉM (UASG: 160166)

Material de consumo odontológico

Lote 680: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. RESINA BISACRÍLICA NANOPARTICULADA PARA A CONFECÇÃO DE PROVISÓRIOS (MÚLTIPLOS ELEMENTOS E UNITÁRIOS). APRESENTAÇÃO EM CARTUCHOS DE 67G, COMPOSTO POR DIMETACRILATOS, INICIADORES, PLASTIFICADORES, PIGMENTOS E PARTÍCULAS DE CARGA NANOMÉTRICAS (SÍLICA AMORFA E COLOIDAL). COR A3. PADRÃO DE REFERÊNCIA: PROTEMP 4 / 3M..

PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos laboratoriais, tais como: Kits, reagentes, testes, enzimas, etc. Destinados as seções de pesquisa do IEC. Atende TR: SAPAT 32/2016; SAPAR 10, 31, 52/2016; SABMI 02/2016; SAMAM 166/2016

Lote 38: DOSADOR QUIMICO. Iniciadores SSUr - Marca: Sigma R221: 5 -GGTTCCTTTCCTGATTTACG-3 R332: 5 -GGC CGGTAAAGGCCGAATAG-3 Fabricar na escala de síntese de 25nMols cada primer Atende item 9 do TR SAPAR 52/2016..
Lote 39: DOSADOR QUIMICO. Iniciadores SSUr - Marca: Sigma R223: 5 -TCC CAT CGC AAC CTC GGT T-3 R333: 5 -AAA GCG GGC GCG GTG CTG-3 Fabricar na escala de síntese de 25nMols cada primer Atende item 10 do TR SAPAR 52/2016..
Lote 40: DOSADOR QUIMICO. Iniciadores K26 (haspb)- Marca: Sigma K26f : 5 -ACGAAGGACTCCGCAAAG-3 K26r: 5 -TTCCCATCGTTTTGCTG-3 Fabricar na escala de síntese de 25nMols cada primer Atende item 11 do TR SAPAR 52/2016..
Lote 41: DOSADOR QUIMICO. Iniciadores Citocromo b Marca: Sigma Cytb Vert1: 5 CCCCTCAGAATGATATTTGTCCTCA 3 Cytb Vert2: 5 GCHGAYACHWVHHYHGCHTTYTCHTC 3 Atende item 12 do TR SAPAR 52/2016..
Lote 42: DOSADOR QUIMICO. Iniciadores SSUr Marca: Sigma Lu.18SrRNA-1S: 5 TGCCAGTAGTTATATGCTTG 3 Lu.18SrRNA-1R: 5 TTACGCGCCTGCTGCCTTCC 3 Atende item 13 do TR SAPAR 52/2016..
Lote 43: DOSADOR QUIMICO. Iniciadores Citocromo b Marca: Sigma Cyt b Forwrad: 5 CGAAGCTTGATATGAAAAACCATCGTTG 3 Cyt b Reverse: 5 TGTAGTTRTCWGGGTCHCCTA 3 Atende item 14 do TR SAPAR 52/2016..

DF ( BRASÍLIA ): POLÍCIA MILITAR DO DISTRITO FEDERAL (UASG: 926016)

Instrumentos de menor potencial ofensivo e agentes químicos lacrimogêneos.

Lote 1: SINALIZADOR PIROTÉCNICO. Armadilha Iluminativa composta por artefato pirotécnico com iniciador tipo EOT, duas hastes metálicas e cordão de acionamento metálico de no mínimo 20 m..

13/12/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos de uso laboratorial, tais como: oligonucleotídeos, sondas, kits e reagentes.

Lote 1: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR ZIK NS5 ****. Descrição: Sequência: 5 - AAR TAC ACA TAC CAR AAC AAA GTG GT-3 . Escala de síntese: 250 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 01 SAARB 092/2016).
Lote 2: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR ZIK NS5 ****. Descrição: Sequência: 5 - TCC RCT CCC YCT YTG GTC TTG-3 . Escala de síntese: 250 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 02 SAARB 092/2016).
Lote 4: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR - ZIKAV ENV ****. Descrição: Sequência: 5´-CCGCTGCCCAACACAAG-3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 04 SAARB 092/2016).
Lote 5: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR - ZIKAV ENV ****. Descrição: Sequência: 5´-CCACTAACGTTCTTTTGCAGACAT-3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 05 SAARB 092/2016).
Lote 7: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR VDEN **** F. Descrição: Sequência: 5´- GGTTAGAGGAGACCCCTCCC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 07 SAARB 092/2016).
Lote 8: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR - VDEN **** R. Descrição: Sequência: 5´- GAGACAGCAGGATCTCTGGTCT -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 08 SAARB 092/2016).
Lote 10: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR RNASE P F. Descrição: Sequência: 5 - AGA TTT GGA CCT GCG AGC G -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 10 SAARB 092/2016).
Lote 11: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR RNASE P R. Descrição: Sequência: 5 - GAG CGG CTG TCT CCA CAA GT -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 11 SAARB 092/2016).
Lote 13: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador Ph-M-2FM . Sequência: 5´- GGVMTSMTHAATTAYCAGTGYCA -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 01 SAARB 094/2016).
Lote 14: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador Ph-M-3RM. Sequência: 5´- CAYCTYCKNGARCTNARRCA -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 02 SAARB 094/2016).
Lote 15: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador PHLV- END . Sequência: 5´- GGGGGGGGGGACACAAAG -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 03 SAARB 094/2016).
Lote 16: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador PH-S-DR-RVF . Sequência: 5´- AAAGCTGGGGTGCATCAT -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 04 SAARB 094/2016).
Lote 17: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador BUN-S. Sequência: 5´- AGTAGTGTGCTCCAC-3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 05 SAARB 094/2016).
Lote 18: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador BUN-C. Sequência: 5´- AGTAGTATACTCCAC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 06 SAARB 094/2016).
Lote 19: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador BS-S256. Sequência: 5´- GTGGGGTCCAATTTGC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 07 SAARB 094/2016).
Lote 20: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador BS-C256. Sequência: 5´- TGAACCCTATGCATCT -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado.Oligonucleotídeo sintético personalizado iniciador BS-C256. Sequência: 5´- TGAACCCTATGCATCT -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 08 SAARB 094/2016).
Lote 21: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador NPhlebo1 (S). Sequência: 5´- ATGGARGGITTTGTIWSICIICC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 09 SAARB 094/2016).
Lote 22: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador NPhlebo1 (NS). Sequência: 5´- AARTTRCTIGWIGCYTTIARIGTIGC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 10 SAARB 094/2016).
Lote 23: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador NPhlebo2 (S). Sequência: 5´- WTICCIAAICCIYMSAARATG -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 11 SAARB 094/2016).
Lote 24: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador NPhlebo2 (NS). Sequência: 5´- TCYTCYTTRTTYTTRARRTARCC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 12 SAARB 094/2016).
Lote 25: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador cFD2 (S). Sequência: 5´- GTGTCCCAGCCGGCGGTGTCATCAGC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 13 SAARB 094/2016).
Lote 26: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador MA (NS). Sequência: 5´- CATGATGGGRAARAGRGARRAG -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 14 SAARB 094/2016).
Lote 27: DOSADOR QUIMICO. Oligonucleotídeo sintético personalizado iniciador MAY 1 (M2W). Sequência: 5´- YAGAGCDTTTTCGCAYSTRGCHW -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. (Item 15 SAARB 094/2016).
Lote 2: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR ZIK NS5 ****. Descrição: Sequência: 5 - TCC RCT CCC YCT YTG GTC TTG-3 . Escala de síntese: 250 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 02 SAARB 092/2016).

05/12/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de reagentes e kits destinados a seção de arbovirologia do IEC.

Lote 24: DOSADOR QUIMICO. ENZIMA TRANSCRIPTASE REVERSA SUPERSCRIPT III Descrição: A Transcriptase Reversa (RT) SuperScript® III é um mutante da RT SuperScript® II que é ativa a 50 ¨ C e tem uma semi - vida de 220 minutos , proporcionando maior especificidade com os iniciadores específicos do gene e o rendimento mais elevado de DNAc de todos as RTs . É ideal para RT-PCR de um gene específico ou para a geração de DNAc a partir de amostras totais ou poli ( A) + RNA. Sugestão: Marca Invitrogen, Cód. **** ou similar desde que atenda a exata descrição e forma de apresentação solicitadas neste PBS. Apresentação: Caixa para 50 reações contendo: 1 (um) tubo com 50 µL de Superscript III (200U/µL), 1 (um) tubo com Tampão de primeira-fita 5x (250 mM Tris-HCl (pH 8.3), 375 mM KCl, 15 mM MgCl2) e 1 (um) tubo com 500 µL de DTT à 100mM. (Item 08 SAARB 095/2016).
Lote 26: DOSADOR QUIMICO. M-MLV TRANSCRIPTASE REVERSA Descrição: Enzima polimerase de DNA recombinante que sintetiza uma cadeia de DNA complementar a partir de uma cadeia simples de RNA, DNA ou um hibrido de RNA:DNA. Pode ser utilizada na para obtençao de primeira cadeia de cDNA , a extensão do iniciador , seuqenciamento de dsDNA , bibliotecas de cDNA e no RT-PCR. Caracteristicamente, não possui actividade de endonuclease de DNA e tem uma atividade de RNAase H inferior. Apresenta atividade ótima a 37 ¨ C. Obtida a partir de E. coli que expressam o gene pol de M - MLV em plasmídeo. Teste de desempenho e qualidade: Pureza por SDS-PAGE ; endodeoxyribonuclease , ensaios exodeoxyribonuclease , e ribonuclease ; de rendimento e de comprimento do produto cDNA. Sugestão: marca Invitrogen, frasco com c/ ****, COD. ****, cód. **** ou similar desde que atenda a exata descrição e forma de apresentação solicitadas neste PBS. (Item 10 SAARB 095/2016).

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.