Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Iniciadores |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

SP ( CAMPINAS ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/SECRETARIA DE DEFESA AGROPECUÁRIA/COORDENAÇÃO GERAL DE APOIO LABORATORIAL/LABORATÓRIO NACIONAL AGROPECUÁRIO - LANAGRO/SP (UASG: 130102)

Pregão SRP para a aquisição de Kits de Biologia Molecular grupo 161 em proveito do Lanagro-SP.

Lote 1: ANALISADOR - PEÇA/COMPONENTE. KIT BAX PARA DETECÇÃO DE ESCHERICHIA COLI STEC PAINEL 1: O26, O111 E O121 RT (REFERÊNCIA: DUPONT ****), PARA IDENTIFICAÇÃO DAS ESPÉCIES DE ESCHERICHIA COLI PRODUTORAS DE TOXINA DE SHIGA, ATRAVÉS DA REAÇÃO EM CADEIA DE POLIMERASE (PCR) EM TEMPO REAL CONFORME ESTABELECIDO NO MÉTODO MLG 5B.05 - DETECTION AND ISOLATION OF NON-O157 SHIGA TOXIN-PRODUCING ESCHERICHIA COLI (STEC) FROM MEAT PRODUCTS AND CARCASS AND ENVIRONMENTAL SPONGES (DETECÇÃO E ISOLAMENTO DE ESCHERICHIA COLI PRODUTORAS DE TOXINA SHIGA (STEC) NÃO O157 EM PRODUTOS CÁRNEOS, CARCAÇAS E AMOSTRAS AMBIENTAIS). CONTEÚDO DETALHADO DO KIT PARA 48 TESTES: FRASCO COM PROTEASE, FRASCO DE TAMPÃO LISE, 48 TUBOS COM OS TABLETES PARA PCR CONTENDO OS INICIADORES OU PRIMERS, A POLIMERASE, OS NUCLEOTÍDEOS E O CONTROLE POSITIVO, ALÉM DAS RESPECTIVAS TAMPAS ÓPTICAS PARA OS TUBOS DE PCR. O KIT TAMBÉM DEVERÁ ESTAR ACOMPANHADO DOS TUBETES E RESPECTIVAS TAMPAS EM NÚMEROS SUFICIENTES PARA A REALIZAÇÃO DO PROCEDIMENTO DE REGROW E DESNATURAÇÃO DO MATERIAL NOS BLOCOS DE AQUECIMENTO.OS KITS SERÃO UTILIZADOS PARA A DETERMINAÇÃO PRESUNTIVA DE ESCHERICHIA COLI ****:H7 - MLG **** (FSIS/USDA) QUE INDICA A UTILIZAÇÃO DO EQUIPAMENTO BAX® SYSTEM Q7 FABRICADO PELA D.
Lote 2: ANALISADOR - PEÇA/COMPONENTE. KIT BAX PARA DETECÇÃO DE ESCHERICHIA COLI STEC PAINEL 2: O45, O103 E O145 RT (REFERÊNCIA: DUPONT ****), PARA IDENTIFICAÇÃO DAS ESPÉCIES DE E.COLI PRODUTORAS DE TOXINA DE SHIGA, ATRAVÉS DA REAÇÃO EM CADEIA DE POLIMERASE (PCR) EM TEMPO REAL CONFORME ESTABELECIDO NO MÉTODO MLG 5B.05 - DETECTION AND ISOLATION OF NON-O157 SHIGA TOXIN-PRODUCING ESCHERICHIA COLI (STEC) FROM MEAT PRODUCTS AND CARCASS AND ENVIRONMENTAL SPONGES (DETECÇÃO E ISOLAMENTO DE ESCHERICHIA COLI PRODUTORAS DE TOXINA SHIGA (STEC) NÃO O157 EM PRODUTOS CÁRNEOS, CARCAÇAS E AMOSTRAS AMBIENTAIS).CONTEÚDO DETALHADO DO KIT PARA 48 TESTES: FRASCO COM PROTEASE, FRASCO DE TAMPÃO LISE, 48 TUBOS COM OS TABLETES PARA PCR CONTENDO OS INICIADORES OU PRIMERS, A POLIMERASE, OS NUCLEOTÍDEOS E O CONTROLE POSITIVO, ALÉM DAS RESPECTIVAS TAMPAS ÓPTICAS PARA OS TUBOS DE PCR. O KIT TAMBÉM DEVERÁ ESTAR ACOMPANHADO DOS TUBETES E RESPECTIVAS TAMPAS EM NÚMEROS SUFICIENTES PARA A REALIZAÇÃO DO PROCEDIMENTO REGROW E DESNATURAÇÃO DO MATERIAL NOS BLOCOS DE AQUECIMENTO, CONFORME INDICADO PELA METODOLOGIA.OS KITS SERÃO UTILIZADOS PARA A DETERMINAÇÃO PRESUNTIVA DE ESCHERICHIA COLI ****:H7 - MLG **** (FSIS/USDA) QUE INDICA A UTILIZAÇÃO DO EQUIPAMENTO BAX® SYSTEM Q7 FABRICADO PELA DUPONT.
Lote 3: ANALISADOR - PEÇA/COMPONENTE. KIT BAX PARA DETECÇÃO DE ESCHERICHIA COLI STEC STX E EAE RT - SCREENING (REFERÊNCIA: DUPONT ****), PARA IDENTIFICAÇÃO DO GENE DE ESCHERICHIA COLI PRODUTORA DE TOXINA DE SHIGA, ATRAVÉS DA REAÇÃO EM CADEIA DE POLIMERASE (PCR) EM TEMPO REAL, CONFORME ESTABELECIDO NO MÉTODO MLG 5B.05 - DETECTION AND ISOLATION OF NON-O157 SHIGA TOXIN-PRODUCING ESCHERICHIA COLI (STEC) FROM MEAT PRODUCTS AND CARCASS AND ENVIRONMENTAL SPONGES (DETECÇÃO E ISOLAMENTO DE ESCHERICHIA COLI PRODUTORAS DE TOXINA SHIGA (STEC) NÃO O157 EM PRODUTOS CÁRNEOS, CARCAÇAS E AMOSTRAS AMBIENTAIS).CONTEÚDO DETALHADO DO KIT PARA 96 TESTES: 1 FRASCO COM PROTEASE (400 MICROLITROS), 2 FRASCOS DE TAMPÃO LISE (12 MILILITROS CADA), 96 TUBOS COM OS TABLETES PARA PCR CONTENDO OS INICIADORES OU PRIMERS, A POLIMERASE, OS NUCLEOTÍDEOS E O CONTROLE POSITIVO, ALÉM DAS RESPECTIVAS TAMPAS ÓPTICAS PARA OS TUBOS DE PCR.OS KITS SERÃO UTILIZADOS PARA A DETERMINAÇÃO PRESUNTIVA DE ESCHERICHIA COLI ****:H7 - MLG **** (FSIS/USDA) QUE INDICA A UTILIZAÇÃO DO EQUIPAMENTO BAX® SYSTEM Q7 FABRICADO PELA DUPONT..
Lote 4: ANALISADOR - PEÇA/COMPONENTE. KIT BAX PARA TRIAGEM AUTOMÁTICA EM TEMPO REAL (RT) DE ESCHERICHIA COLI O157:H7 (REFERÊNCIA DUPONT ****), ATRAVÉS DA REAÇÃO EM CADEIA DE POLIMERASE (PCR), CONFORME ESTABELECIDO NO MÉTODO MLG 5A.04 - FSIS PROCEDURE FOR THE USE OF ESCHERICHIA COLI O157:H7 SCREENING TESTS FOR MEAT PRODUCTS AND CARCASS AND ENVIRONMENTAL SPONGES (PROCEDIMENTO PARA ENSAIO DE ESCHERICHIA COLI O157:H EM PRODUTOS CÁRNEOS, CARCAÇAS E AMOSTRAS AMBIENTAIS).CONTEÚDO DETALHADO DO KIT PARA 96 TESTES: 01 FRASCO COM PROTEASE (400UL), 02 FRASCOS DE TAMPÃO LISE (12ML CADA), 96 TUBOS COM OS TABLETES PARA PCR CONTENDO OS INICIADORES OU PRIMERS, A POLIMERASE, OS NUCLEOTÍDEOS E O CONTROLE POSITIVO, ALÉM DAS RESPECTIVAS TAMPAS ÓPTICAS PARA OS TUBOS DE PCR. OS KITS SERÃO UTILIZADOS PARA A DETERMINAÇÃO PRESUNTIVA DE ESCHERICHIA COLI ****:H7 - MLG **** (FSIS/USDA) QUE INDICA A UTILIZAÇÃO DO EQUIPAMENTO BAX® SYSTEM Q7 FABRICADO PELA DUPONT.1)CALDO MTSB (CALDO TRIPCASE SOYA MODIFICADO) PARA O PROCEDIMENTO DE ENRIQUECIMENTO EM NÚMERO DE FRASCOS SUFICIENTE O PREPARO DE 96 AMOSTRAS;2) 96 MICROTUBOS CÔNICO, REFERÊNCIA T100 4G SIMPORT PARA A REALIZAÇÃO DO PROCEDIMENTO REGROW E DESNATURAÇÃO DO MATERIAL NOS BLOCOS DE AQUECIMENTO.
Lote 17: ANALISADOR - PEÇA/COMPONENTE. KIT REAGENTE PARA TRIAGEM AUTOMÁTICA DE LISTERIA MONOCYTOGENES, PARA OBTENÇÃO DE RESULTADOS EM 24 HORAS, ATRAVÉS DA REAÇÃO EM CADEIA DE POLIMERASE (PCR) CONFORME ESTABELECIDO NO MÉTODO MLG **** - FSIS PROCEDURE FOR THE USE OF A LISTERIA MONOCYTOGENES POLYMERASE CHAIN REACTION (PCR) SCREENING TEST (PROCEDIMENTO FSIS PARA ENSAIO DE TRIAGEM DE LISTERIA MOCYTOGENES ATRAVÉS DA REAÇÃO EM CADEIA DA POLIMERASE PCR ) CONTEUDO DETALHADO DO KIT PARA 96 TESTES: 01 FRASCO COM 400 MICROLITROS DE PROTEASE, 02 FRASCOS CONTENDO 12 ML CADA UM DO AGENTE TAMPÃO DE LISE (I) E 02 FRASCOS COM 12 ML CADA UM DO AGENTE DE LISE (II) , 96 TUBOS COM OS TABLETES PARA A REAÇÃO EM CADEIA DE POLIMERASE (PCR) CONTENDO OS INICIADORES OU PRIMERS, POLIMERASE, NUCLEOTÍDEOS E CONTROLE POSITIVO, 96 TAMPAS ÓPTICAS PARA FECHAMENTO DOS TUBOS DE PCR, ACOMPANHADOS DO CALDO PARA ENRIQUECIMENTO LEB 24 HORAS SUFICIENTES PARA A EXECUÇÃO DOS TESTES..
Lote 18: ANALISADOR - PEÇA/COMPONENTE. KIT REAGENTE PARA TRIAGEM AUTOMÁTICA SALMONELLA SPP, ATRAVÉS DA REAÇÃO EM CADEIA DE POLIMERASE (PCR) CONFORME ESTABELECIDO NO MÉTODO MLG4C.06 - FSIS PROCEDURE FOR THE USE OF A POLYMERASE CHAIN REACTION (PCR) ASSAY FOR SCREENING SALMONELLA IN MEAT, POULTRY, PASTEURIZED EGG, AND CATFISH PRODUCTS AND CARCASS AND ENVIRONMENTAL SPONGES (PROCEDIMENTO FSIS PARA REAÇÃO EM CADEIA DA POLIMERASE ( PCR) PARA ENSAIO DE TRIAGEM DE SALMONELLA SPP EM CARNES, AVES , OVOS PASTEURIZADO, PRODUTOS DA PESCA, CARCAÇAS E AMOSTRAS AMBIENTAIS) CONTEUDO DETALHADO DO KIT PARA 96 TESTES: 01 FRASCO DE 400 ML DE PROTEASE, 02 FRASCOS DE 12ML CADA UM DO AGENTE TAMPÃO DE LISE, 96 TUBOS COM OS TABLETES PARA A REAÇÃO EM CADEIA DE POLIMERASE (PCR) CONTENDO OS INICIADORES OU PRIMERS, POLIMERASE, NUCLEOTÍDEOS E CONTROLE POSITIVO, 96 TAMPAS ÓPTICAS PARA FECHAMENTO DOS TUBOS DE PCR. CAIXA CONTENDO 96 TESTES..

RS ( BENTO GONÇALVES ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/EMBRAPA/CNPUV (UASG: 135033)

Contratação de empresa para fornecimento de reagentes e materiais laboratoriais para a Embrapa Uva e Vinho.

Lote 47: REAGENTE PARA TINTA. Conjunto de iniciadores e respectiva sonda de RT-PCR. Reagentes necessários para o diagnóstico de vírus por RT-PCR em tempo real **** CGTTCCTGGTCGCAGAA 25 nmol, **** GCGAAGATGGACTCCAGTA 25 nmol, **** 5´-FAM CAGACCCCTTCATGGAAAGACAGG 5´TAMRA 5 nmol. Escala de síntese dos iniciadores: 25 nmol Escala de síntese da sonda: 5nmol..

31/10/2016 - SP: SEC. SAÚDE/COORDENADORIA DE SERVIÇOS DE SAÚDE/INSTITUTO "LAURO DE SOUZA LIMA"-BAURU

Aquisição de meio de cultura e outros materiais para a Equipe Técnica de Microbiologia/EQUIPAMENTOS E ARTIGOS DE USO MEDICO, ODONTOLOGICO, HOSPITALAR E LABORATORIAL/REAGENTES E INSUMOS PARA BIOLOGIA MOLECULAR

Lote 2: OLIGONUCLEOTIDEOS INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, CONTENDO 19 BASES
Lote 3: OLIGONUCLEOTIDEOS INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, CONTENDO 20 BASES
Lote 4: OLIGONUCLEOTIDEOS INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 21 BASES
Lote 5: OLIGONUCLEOTIDEOS INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, CONTENDO 22 BASES
Lote 6: OLIGONUCLEOTIDEOS INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, CONTENDO 23 BASES

28/10/2016 - SP ( BAURU ): INST. LAURO DE SOUZA LIMA, EM BAURU

MATERIAL DE CONSUMO

Lote 2: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 19 BASES + 2 BASES DEGENERADAS, NA CONCENTRACAO DE 200 NANOMOLES, LIOFILIZADOS, COM NUCLEOTIDEOS DE SEQUENCIA VARIADA, VALIDADE MINIMA DE 01 (UM ) ANO A CONTAR DA ENTREGA NO ALMOXARIFADO, ACONDICIONADO EM FRASCO APROPRIADO. DESSALINIZADOS. COM CERTIFICADO DE ANALISE, ROTULO COM NR. DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO E PROCEDENCIA
Lote 3: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, CONTENDO 20 BASES, NA CONCENTRAÇÃO DE 200 NANOMOLES ( RNASE P R ), VALIDADE MINIMA DE 01(UM) ANO A CONTAR DA DATA DE ENTREGA NO ALMOXARIFADO, ACONDICIONADO EM FRASCO APROPRIADO. ACOMPANHA CERTIFICADO, ROTULO COM NR. DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO, PROCEDENCIA E EMBALAGEM APROPRIADA P/ PRODUTO
Lote 5: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 22 BASES, NA CONCENTRAÇÃO DE 50 NANOMOLOES, PÓ LIOFILIZADO,COM NUCLEOTÍDEOS DE COMPRIMENTO VARIADO, VALIDADE MINIMA DE 01(UM) ANO A CONTAR DA DATA DE ENTREGA NO ALMOXARIFADO, ACONDICIONADO EM FRASCO APROPRIADO, ROTULO COM NR. DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO, PROCEDENCIA E EMBALAGEM APROPRIADA P/ PRODUTO
Lote 6: OLIGONUCLEOTIDEOS, INICIADORES (OU PRIMERS), PARA USO EM BIOLOGIA MOLECULAR E PCR, COM 23 BASES NORMAIS E 2 DEGENERADAS, NA CONCENTRACAO DE 50 NANOMOLES, LIOFILIZADOS COM SEQUENCIA DE NUCLEOTIDEOS VARIADA, VALIDADE MINIMA DE 01(UM) ANO A CONTAR DA DATA DE ENTREGA NO ALMOXARFFADO, ACONDICIONADO EM FRASCO APROPRIADO. COM CERTIFICADO DE ANALISE. DESSALINIZADOS, ROTULO COM NR. DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO, PROCEDENCIA E EMBALAGEM APROPRIADA P/ PRODUTO

26/10/2016 - SC ( CONCÓRDIA ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/EMBRAPA/CNPSA (UASG: 135030)

Aquisição de reagentes de laboratório.

Lote 135: LISTA DE ESTOQUE. Agencourt RNAClean XP - Reagente RNA XP Ampure beads para extração e purificação de RNA produtos de ácidos nucleicos gerados em reações enzimáticas comuns, tais como síntese de cDNA e reações de transcrição in vitro (IVT). Este método utiliza Imobilização de Fase Sólida reversível (SPRID), baseada na tecnologia baseada de esferas magnéticas. É formatado exclusivamente para purificação de ambos os passos de procedimentos baseados em cDNA e de cRNA. Com a utilização de tecnologia SPRID, o sistema Agencourt RNAClean XP não usa solventes orgânicos, filtração a vácuo, ou por centrifugação. O kit deve oferecer recuperação de ácido nucleico superior e pureza para uso em microarray e RNA-Seq. Deve realizar a purificação dos produtos de ácidos nucleicos pequenos e grandes; a remoção completa de sais, iniciadores não incorporados e dNTPs, não necessitar de centrifugação, filtração ou precipitação. Frasco com 40 mL. Marca referência: Beckman Coulter, cát. ****. Solicitado 1 Frasco, temperatura -15 a -25ºC..

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2016 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.