Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Oligonucleotideos |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

RS: HOSPITAL DE CLINICAS DE PORTO ALEGRE /(1) SETOR DE COMPRAS

MATERIAL LABORATORIO/DIAGNOSTICOS - DIVS

Lote 7: PAR DE PRIMERS (OLIGONUCLEOTÍDEOS) - 1 MARCADO C/ FLUOR.

CE ( FORTALEZA ): GOVERNO DO ESTADO DO CEARÁ (UASG: 943001)

Registro de Preços para futuras e eventuais Aquisições de Primers, Enzimas de Restrição reagentes para extração de DNA, para os Laboratórios de Biologia Molecular, Imunohematologia e HLA, de acordo com as especificações e quantitativos previstos no Anexo I Termo de Referência deste Edital.

Lote 1: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 2: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 3: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 4: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 5: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 6: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 7: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 8: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 9: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 10: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 11: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 12: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 13: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 14: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 15: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 16: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 17: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 18: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 19: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 20: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 21: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 22: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 23: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 24: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.
Lote 2: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.

SP ( CAMPINAS ): UNICAMP-CAISM

MATERIAL DE USO LABORATORIAL

Lote 3: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 26 BASES; PO LIOFILIZADO, B23, NA CONCENTRACAO DE 25 NANOMOLES, COM SEQUENCIA 5'-3' TGG GTC TAC GTC GAT GGC ATG ACA AC, VALIDADE MINIMA DE 12 MESES A PARTIR DA DATA DE ENTREGA, ACONDICIONADO EM FRASCO APROPRIADO QUE GARANTA A INTEGRIDADE DO PRODUTO, ROTULO COM NOME DO PRODUTO, NUMERO DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO E PROCEDENCIA
Lote 4: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 20 BASES; PO LIOFILIZADO, RTG1, NA CONCENTRACAO DE 25 NANOMOLES, COM SEQUENCIA 5'-3' GGC ATT CCT CGT TGA AGA TT, VALIDADE MINIMA DE 12 MESES A PARTIR DA DATA DE ENTREGA, ACONDICIONADO EM FRASCO APROPRIADO QUE GARANTA A INTEGRIDADE DO PRODUTO, ROTULO COM NOME DO PRODUTO, NUMERO DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO E PROCEDENCIA
Lote 5: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 25 BASES; PO LIOFILIZADO, B22, NA CONCENTRACAO DE 25 NANOMOLES, COM SEQUENCIA 5'-3' AAC GGG CGA GTA GCA CCT GAG GAG A, VALIDADE MINIMA DE 12 MESES A PARTIR DA DATA DE ENTREGA, ACONDICIONADO EM FRASCO APROPRIADO QUE GARANTA A INTEGRIDADE DO PRODUTO, ROTULO COM NOME DO PRODUTO, NUMERO DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO E PROCEDENCIA
Lote 6: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 20 BASES; PO LIOFILIZADO, RTG2, NA CONCENTRACAO DE 25 NANOMOLES, COM SEQUENCIA 5'-3' CCT TGG CCG ATA GGT CTA GG, VALIDADE MINIMA DE 12 MESES A PARTIR DA DATA DE ENTREGA, ACONDICIONADO EM FRASCO APROPRIADO QUE GARANTA A INTEGRIDADE DO PRODUTO, ROTULO COM NOME DO PRODUTO, NUMERO DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO E PROCEDENCIA
Lote 7: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 20 BASES; PO LIOFILIZADO, HL1 512PB, NA CONCENTRACAO DE 25 NANOMOLES, COM SEQUENCIA 5'-3' TAGAGATAGGAAACCAACTC, VALIDADE MINIMA DE 12 MESES A PARTIR DA DATA DE ENTREGA, ACONDICIONADO EM FRASCO APROPRIADO QUE GARANTA A INTEGRIDADE DO PRODUTO, ROTULO COM NOME DO PRODUTO, NUMERO DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO E PROCEDENCIA
Lote 8: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 20 BASES; PO LIOFILIZADO, HL2 512PB, NA CONCENTRACAO DE 25 NANOMOLES, COM SEQUENCIA 5'-3' CTCGGGTTAATGTTGCATGA, VALIDADE MINIMA DE 12 MESES A PARTIR DA DATA DE ENTREGA, ACONDICIONADO EM FRASCO APROPRIADO QUE GARANTA A INTEGRIDADE DO PRODUTO, ROTULO COM NOME DO PRODUTO, NUMERO DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO E PROCEDENCIA
Lote 9: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 18 BASES; PO LIOFILIZADO, P3, NA CONCENTRACAO DE 25 NANOMOLES, COM SEQUENCIA 5'-3' AGA CAG AGA AGA CTC TTG, VALIDADE MINIMA DE 12 MESES A PARTIR DA DATA DE ENTREGA, ACONDICIONADO EM FRASCO APROPRIADO QUE GARANTA A INTEGRIDADE DO PRODUTO, ROTULO COM NOME DO PRODUTO, NUMERO DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO E PROCEDENCIA
Lote 10: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 21 BASES; PO LIOFILIZADO, P5, NA CONCENTRACAO DE 25 NANOMOLES, COM SEQUENCIA 5'-3' TCA TTC GTC TGT TTC CCA TTC, VALIDADE MINIMA DE 12 MESES A PARTIR DA DATA DE ENTREGA, ACONDICIONADO EM FRASCO APROPRIADO QUE GARANTA A INTEGRIDADE DO PRODUTO, ROTULO COM NOME DO PRODUTO, NUMERO DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO E PROCEDENCIA
Lote 11: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 20 BASES; PO LIOFILIZADO, G73, NA CONCENTRACAO DE 25 NANOMOLES, COM SEQUENCIA 5'-3' GAA GAG CCA AGG ACA GGT AC, VALIDADE MINIMA DE 12 MESES A PARTIR DA DATA DE ENTREGA, ACONDICIONADO EM FRASCO APROPRIADO QUE GARANTA A INTEGRIDADE DO PRODUTO, ROTULO COM NOME DO PRODUTO, NUMERO DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO E PROCEDENCIA
Lote 12: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 20 BASES; PO LIOFILIZADO, G74, NA CONCENTRACAO DE 25 NANOMOLES, COM SEQUENCIA 5'-3' CAA CTT CAT CCA CGT TCA CC, VALIDADE MINIMA DE 12 MESES A PARTIR DA DATA DE ENTREGA, ACONDICIONADO EM FRASCO APROPRIADO QUE GARANTA A INTEGRIDADE DO PRODUTO, ROTULO COM NOME DO PRODUTO, NUMERO DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO E PROCEDENCIA
Lote 15: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 25 BASES; PO LIOFILIZADO, MIE4, NA CONCENTRACAO DE 25 NANOMOLES, COM SEQUENCIA 5'-3' CCA AGC GGC CTC TGA TAA CCA AGC C, VALIDADE MINIMA DE 12 MESES A PARTIR DA DATA DE ENTREGA, ACONDICIONADO EM FRASCO APROPRIADO QUE GARANTA A INTEGRIDADE DO PRODUTO, ROTULO COM NOME DO PRODUTO, NUMERO DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO E PROCEDENCIA
Lote 16: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 25 BASES; PO LIOFILIZADO, MIE5, NA CONCENTRACAO DE 25 NANOMOLES, COM SEQUENCIA 5'-3' CAG CAC CAT CCT CCT CTT CCT CTG G, VALIDADE MINIMA DE 12 MESES A PARTIR DA DATA DE ENTREGA, ACONDICIONADO EM FRASCO APROPRIADO QUE GARANTA A INTEGRIDADE DO PRODUTO, ROTULO COM NOME DO PRODUTO, NUMERO DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO E PROCEDENCIA
Lote 17: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 20 BASES; PO LIOFILIZADO, IE1, NA CONCENTRACAO DE 25 NANOMOLES, COM SEQUENCIA 5'-3' CCA CCC GTG GTG CCA GCT CC, VALIDADE MINIMA DE 12 MESES A PARTIR DA DATA DE ENTREGA, ACONDICIONADO EM FRASCO APROPRIADO QUE GARANTA A INTEGRIDADE DO PRODUTO, ROTULO COM NOME DO PRODUTO, NUMERO DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO E PROCEDENCIA
Lote 18: OLIGONUCLEOTIDEOS, INICIADORES, PARA USO EM BIOLOGIA MOLECULAR, COM 20 BASES; PO LIOFILIZADO, IE2, NA CONCENTRACAO DE 25 NANOMOLES, COM SEQUENCIA 5'-3' CCC GCT CCT CCT GAC CAC CC, VALIDADE MINIMA DE 12 MESES A PARTIR DA DATA DE ENTREGA, ACONDICIONADO EM FRASCO APROPRIADO QUE GARANTA A INTEGRIDADE DO PRODUTO, ROTULO COM NOME DO PRODUTO, NUMERO DE LOTE, DATA DE FABRICACAO/VALIDADE, COMPOSICAO E PROCEDENCIA

SP: SEC. DESENVOLVIMENTO ECONÔMICO, CIÊNCIA, TECNOLOGIA E INOVAÇAO/UNIV.ESTADUAL DE CAMPINAS - UNICAMP/UNIVERSIDADE ESTADUAL DE CAMPINAS-UNICAMP

Reagentes para Rotina Diagnóstica/EQUIPAMENTOS E ARTIGOS DE USO MEDICO, ODONTOLOGICO, HOSPITALAR E LABORATORIAL/REAGENTES QUIMICOS E BIOLOGICOS

Lote 3: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 26 Bases; Po Liofilizado, B23; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 Tgg Gtc Tac Gtc Gat Ggc Atg Aca Ac; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 4: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Rtg1; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 Ggc Att Cct Cgt Tga Aga Tt; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 5: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 25 Bases; Po Liofilizado, B22; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 Aac Ggg Cga Gta Gca Cct Gag Gag A; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 6: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Rtg2; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 Cct Tgg Ccg Ata Ggt Cta Gg; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 7: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Hl1 512pb; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 TAGAGATAGGAAACCAACTC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 8: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Hl2 512pb; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CTCGGGTTAATGTTGCATGA; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 9: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 18 Bases; Po Liofilizado, P3; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 AGA CAG AGA AGA CTC TTG; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 10: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 21 Bases; Po Liofilizado, P5; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 TCA TTC GTC TGT TTC CCA TTC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 11: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, G73; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 GAA GAG CCA AGG ACA GGT AC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 12: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, G74; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CAA CTT CAT CCA CGT TCA CC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 15: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 25 Bases; Po Liofilizado, Mie4; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CCA AGC GGC CTC TGA TAA CCA AGC C; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 16: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 25 Bases; Po Liofilizado, Mie5; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CAG CAC CAT CCT CCT CTT CCT CTG G; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 17: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Ie1; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CCA CCC GTG GTG CCA GCT CC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 18: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Ie2; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CCC GCT CCT CCT GAC CAC CC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****

SP ( SAO PAULO ): HOSP. DAS CLINICAS, SAO PAULO

MATERIAL DE USO LABORATORIAL

Lote 1: REAGENTE PARA BIOLOGIA MOLECULAR, SEQUENCIA DE OLIGONUCLEOTIDEOS PARA PESQUISA DE BETA GLOBINA, FRASCOS, DEVEM SER LIOFILIZADOS, DEVEM SER SINTETIZADOS DE ACORDO COM A SEQUENCIA ESPECIFICADA, DEVER PERMANECER ESTAVEL POR PERIODO IGUAL OU SUPERIOR A UM ANO A - 20 GRAUS CELSIUS, OS FRASCOS DEVERÃO SER IDENTIFICADOS CONFORME SEQUENCIA SINTETIZADA

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.