Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Taqman |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

SP: SEC. SAÚDE/HOSP. DAS CLÍNICAS DA FAC.DE MED.DA USP/HC.DA FACULDADE DE MEDICINA DA UNIV.S.PAULO

reagentes e insumos para uso laboratorial/EQUIPAMENTOS E ARTIGOS DE USO MEDICO, ODONTOLOGICO, HOSPITALAR E LABORATORIAL/COMPONENTES DE EQUIPAMENTOS DE USO LABORATORIAL

Lote 3: PLACA OPTICA DE 96 WELL COMPATIVEL COM SISTEMA ABI **** CONTENDO MIX DE REAGENTES (TAQMAN, PRIMER, PROBE -FAM, CONTROLE DNA HUMANO GENE RNASE P) COM VOLUME MÍNIMO DE 50 UL CADA WELL. DEVE APRESENTAR 5 GRUPOS DE PADRÕES (****, ****, ****, ****, **** COPIAS), DUAS POPULAÇÕES DIFERENTES **** E **** COPIAS E 4 CONTROLES NEGATIVOS. REAGENTE DEVE ESTAR AUSENTE DE PARTÍCULAS INFECTANTES OU CONTAMINANTES. DEVERÁ PERMANECER ESTÁVEL POR PERÍODO IGUAL OU SUPERIOR A 01 (HUM) ANO ARMAZENADO A TEMPERATURA DE -15 A -25ºC. O TRANSPORTE E ARMAZENAMENTO DEVEM SER INFORMADOS PELO FABRICANTE E CONSTAR DATA DE FABRICAÇAO, LOTE E VALIDADE. ****

RJ ( RIO DE JANEIRO ): MINISTÉRIO DA SAÚDE/FUNDAÇÃO OSWALDO CRUZ/INSTITUTO OSWALDO CRUZ (UASG: 254463)

Aquisição de material laboratorial conforme Termo de Referência e Edital.

Lote 15: ADAPTADOR. KIT TAQMAN® UNIVERSAL PCR MASTER MIX, SUFICIENTE PARA 200 REAÇÕES. - Marca: APPLIED BIOSYSTEMS Código: **** Referência: **** Complemento: TEMPERATURA PARA ARMAZENAMENTO: 2-8¨C..

SP ( SAO PAULO ): HOSP. DAS CLINICAS, SAO PAULO

MATERIAL DE USO LABORATORIAL

Lote 1: REAGENTE PARA BIOLOGIA MOLECULAR, REAGENTE MASTER MIX P/ PCR QUANTITATIVO P/ SISTEMA TAQMAN, PARA ATE 200 REACOES, EFICIENCIA DE 100%, CONTER DESCRICAO DO PRODUTO, REAGENTE MASTER MIX P/ SISTEMA TAQMAN, COM REFERENCIA PASSIVA ROX

02/01/2017 - AM ( MANAUS ): FUNDAÇÃO DE VIGILÂNCIA EM SAÚDE DO ESTADO DO AMAZONAS/ AMAZONAS

Aquisição de Equipamento de Laboratório

Lote 1: MAQUINA PCR TEMPO REAL, Plataforma integrada para detecção, quantificação e monitoramento em tempo real de produtos amplificados por reações químicas homogêneas, como TaqMan ou SYBR Green, a partir da técnica de PCR; Com capacidade para 96 amostras em microplacas ópticas ou tubos/strips de 0,2ml; Sistema ótico com uma lâmpada halógena para indução da fluorescência, 05 filtros de excitação, 05 filtros de detecção, um detector CCD ``Charge Couple Device``; Acompanhado de: 1 notebook; Software para monitorar a amplificação por PCR a cada ciclo em tempo real, com função multicomponente, que permite a correta interpretação da sobreposição de cores; Software que auxilie no desenho dos primers e sondas.

13/12/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos de uso laboratorial, tais como: oligonucleotídeos, sondas, kits e reagentes.

Lote 6: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE - ZIKAV ENV **** Descrição: Sequência: 5´-6FAM- AGCCTACCT/ZEN/TGACAAGCAGTCAGACACTCAA-IwBkFQ-3´. Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 6-FAM, Int ZEN, 3 Iowa Black FQ, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 06 SAARB 092/2016).
Lote 9: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE - VDEN GEN probe Descrição: Sequência: 5´-6FAM- AAACAGCATATTGACGCTGGGA/3BHQ_2/-3´. Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 6-FAM, Int ZEN, 3 Iowa Black FQ, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 09 SAARB 092/2016).
Lote 12: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE 5 6-HEX/ZEN/3 IBRFQ RNASE P S Descrição: Sequência: 5 - TTC TGA CCT GAA GGC TCT GCG CG -3 . Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 HEX, Int ZEN, 3 Iowa Black FQ, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas e que seja da mesma merca dos itens 5 a 22 deste TR Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 12 SAARB 092/2016).

Estatísticas |

Número de licitações mapeadas com o termo "Taqman"

O Licita Já faz mapeamento estatístico e analisa os maiores compradores de seus produtos e serviços!


Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.