Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Taqman |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

AM ( MANAUS ): FUNDAÇÃO DE VIGILÂNCIA EM SAÚDE DO ESTADO DO AMAZONAS/ AMAZONAS

Aquisição de Equipamento de Laboratório

Lote 1: MAQUINA PCR TEMPO REAL, Plataforma integrada para detecção, quantificação e monitoramento em tempo real de produtos amplificados por reações químicas homogêneas, como TaqMan ou SYBR Green, a partir da técnica de PCR; Com capacidade para 96 amostras em microplacas ópticas ou tubos/strips de 0,2ml; Sistema ótico com uma lâmpada halógena para indução da fluorescência, 05 filtros de excitação, 05 filtros de detecção, um detector CCD ``Charge Couple Device``; Acompanhado de: 1 notebook; Software para monitorar a amplificação por PCR a cada ciclo em tempo real, com função multicomponente, que permite a correta interpretação da sobreposição de cores; Software que auxilie no desenho dos primers e sondas.

13/12/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos de uso laboratorial, tais como: oligonucleotídeos, sondas, kits e reagentes.

Lote 6: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE - ZIKAV ENV **** Descrição: Sequência: 5´-6FAM- AGCCTACCT/ZEN/TGACAAGCAGTCAGACACTCAA-IwBkFQ-3´. Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 6-FAM, Int ZEN, 3 Iowa Black FQ, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 06 SAARB 092/2016).
Lote 9: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE - VDEN GEN probe Descrição: Sequência: 5´-6FAM- AAACAGCATATTGACGCTGGGA/3BHQ_2/-3´. Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 6-FAM, Int ZEN, 3 Iowa Black FQ, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 09 SAARB 092/2016).
Lote 12: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE 5 6-HEX/ZEN/3 IBRFQ RNASE P S Descrição: Sequência: 5 - TTC TGA CCT GAA GGC TCT GCG CG -3 . Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 HEX, Int ZEN, 3 Iowa Black FQ, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas e que seja da mesma merca dos itens 5 a 22 deste TR Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 12 SAARB 092/2016).

12/12/2016 - GO ( GOIÂNIA ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/SECRETARIA DE DEFESA AGROPECUÁRIA/COORDENAÇÃO GERAL DE APOIO LABORATORIAL/LABORATÓRIO NACIONAL AGROPECUÁRIO - LANAGRO/GO (UASG: 130032)

Aquisição de insumos para biologia molecular

Lote 26: REAGENTE PARA TINTA. TAQMAN FAST ADVANCED MASTER MIX, 2X , contendo ROX e UNG na mesma solução, frasco de solução com 50 ml, suficiente Suficiente para **** reações no volume final de 50 ul por reação. Padrão Applied Biosystems. Código: **** ou similar de igual ou superior qualidade com todos os componentes e propriedades na mesma solução. Prazo de validade mínimo de 06 meses a partir da data de entrega do material. Frasco 50 ml.

08/12/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos laboratoriais: Taqman, etanol, acetato, enzimas, albuminas, etc. destinados à Seção de Arbovirologia do Instituto Evandro Chagas.

Lote 3: DOSADOR QUIMICO. Taqman pré-designed SNP genotypin assay marcado com corante VIC/FAM ensaio ****. (Item 03 do SBC SAARB/CIT 102/2016)..
Lote 4: DOSADOR QUIMICO. Taqman pré-designed SNP genotypin assay marcado com corante VIC/FAM ensaio ****. (Item 04 do SBC SAARB/CIT 102/2016)..
Lote 5: DOSADOR QUIMICO. Taqman pré-designed SNP genotypin assay marcado com corante VIC/FAM ensaio ****. (Item 05 do SBC SAARB/CIT ****).
Lote 6: DOSADOR QUIMICO. Taqman pré-designed SNP genotypin assay marcado com corante VIC/FAM ensaio ****. (Item 06 do SBC SAARB/CIT 102/2016)..
Lote 7: DOSADOR QUIMICO. Taqman MicroRNA Assay com 150 reações ****. (Item 07 do SBC SAARB/CIT 102/2016)..
Lote 8: DOSADOR QUIMICO. Taqman MicroRNA Assay com 150 reações ****. (Item 08 do SBC SAARB/CIT 102/2016)..
Lote 9: DOSADOR QUIMICO. Taqman MicroRNA Assay com 150 reações ****. (Item 09 do SBC SAARB/CIT 102/2016)..
Lote 10: DOSADOR QUIMICO. Taqman MicroRNA Assay com 150 reações ****. (Item 10 do SBC SAARB/CIT ****)..
Lote 11: DOSADOR QUIMICO. Taqman MicroRNA Assay com 150 reações ****. (Item 11 do SBC SAARB/CIT 102/2016)..
Lote 12: DOSADOR QUIMICO. Taqman MicroRNA Assay com 150 reações HSA-MIR-376b. (Item 12 do SBC SAARB/CIT 102/2016)..
Lote 13: DOSADOR QUIMICO. Taqman MicroRNA Assay com 150 reações HSA-MIR-30E. (Item 13 do SBC SAARB/CIT 102/2016)..
Lote 14: DOSADOR QUIMICO. Taqman MicroRNA Assay com 150 reações HSA-MIR-15b. (Item 14 do SBC SAARB/CIT 102/2016).
Lote 15: DOSADOR QUIMICO. Taqman MicroRNA Assay com 150 reações HSA-MIR-16. (Item 15 do SBC SAARB/CIT 102/2016)..
Lote 16: DOSADOR QUIMICO. Taqman MicroRNA Assay com 150 reações HSA-MIR-548. (Item 16 do SBC SAARB/CIT 102/2016)..
Lote 45: DOSADOR QUIMICO. Custom Taqman gene envelope E, e gene polymerase do Oropouche vírus, utilizado em ensaios de expressão genética em tempo real, suficiente para 250 reações. (ITEM 06 DO SBC SAARB 104/2016).
Lote 46: DOSADOR QUIMICO. Custom Taqman gene envelope E, e gene polymerase do Shev vírus, utilizado em ensaios de expressão genética em tempo real, suficiente para 250 reações. (ITEM 07 DO SBC SAARB 104/2016).
Lote 47: DOSADOR QUIMICO. Custom Taqman gene envelope E, e gene polymerase do Mayaro vírus, utilizado em ensaios de expressão genética por PCR tempo real, suficiente para 250 reações. (ITEM 08 DO SBC SAARB 104/2016).
Lote 48: DOSADOR QUIMICO. Custom Taqman gene envelope E, e gene polymerase do O Nyong vírus, utilizado em ensaios de expressão genética em PCR tempo real, suficiente para 250 reações. (ITEM 09 DO SBC 104/2016).
Lote 49: DOSADOR QUIMICO. Custom Taqman gene envelope E, e gene polymerase do Rift Valley vírus, utilizado em ensaios de expressão genética em PCR tempo real, suficiente para 250 reações. (ITEM 10 DO SBC SAARB 104/2016).
Lote 50: DOSADOR QUIMICO. Custom Taqman gene envelope E, e gene polymerase do Ross River vírus, utilizado em ensaios de expressão genética em PCR tempo real, suficiente para 250 reações. (ITEM 11 DO SBC SAARB 104/2016).
Lote 51: DOSADOR QUIMICO. Custom Taqman gene envelope E, e gene polymerase do West nile virus, utilizado em ensaios de expressão genética em tempo real, suficiente para 250 reações. (Item 12 do SBC SAARB 104/2016).
Lote 52: DOSADOR QUIMICO. Custom Taqman gene envelope E, e gene polymerase do zica vírus, utilizado em ensaios de expressão genética em tempo real, suficiente para 250 reações.(ITEM 13 DO SBC SAARB 104/2016).
Lote 53: DOSADOR QUIMICO. Custom Taqman gene envelope E, e gene polymerase do vírus da febre amarela, utilizado em ensaios de expressão genética em tempo real, suficiente para 250 reações. (ITEM 14 DO SBC SAARB 104/2016).
Lote 54: DOSADOR QUIMICO. Custom Taqman gene envelope E, e gene polymerase do vírus dengue 4, utilizado em ensaios de expressão genética em tempo real, suficiente para 250 reações.(ITEM 15 DO SBC SAARB 104/2016).

01/12/2016 - SP ( SAO PAULO ): INSTITUTO ADOLFO LUTZ

MATERIAL DE CONSUMO

Lote 2: REAGENTE PARA BIOLOGIA MOLECULAR, REAGENTE MASTER MIX P/ PCR QUANTITATIVO P/ SISTEMA TAQMAN, PARA ATE 200 REACOES, EFICIENCIA DE 100%, CONTER DESCRICAO DO PRODUTO, REAGENTE MASTER MIX P/ SISTEMA TAQMAN, COM REFERENCIA PASSIVA ROX

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.