Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Pregão Eletrônico Edital: 111/2016- Ananindeua Pa |

Atualizado em 21/09/2016. Acesse também licitações mais recentes e baixe os editais.

21/09/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de materiais de uso laboratorial, tais como: sínteses, penicilina, oligonucleotídeos, primers, etc, destinados a diversas seções do IEC.

Lote 1: DOSADOR QUIMICO. Síntese de oligonucleotídeo marcados, (primer) sintetizado para ser utilizado em reações do sequenciador da Applied Biosystems ****, ****. (Item 01 SABMI 091/2016).
Lote 2: DOSADOR QUIMICO. Bases nucleotídicas para confecção de PRIMERs , escala 50 mMol. (Item 02 SABMI 091/2016).
Lote 3: DOSADOR QUIMICO. Penicilina G sódica (****), em pó. Própria para cultura de células. Potência de **** unidades por mg. Embalagem com **** U (10MU). Marca Sigma (catálogo ****) ou similar (Item 01 SAMAM 063/2016).
Lote 4: DOSADOR QUIMICO. Colagenase tipo I. Liofilizada. Isolada de Clostridium histolyticum. Própria para cultura de células. Sem vermelho fenol. Com atividade superior a 125 unidades/mg. Frasco com um grama. Marca GIBCO (catálogo ****) ou similar.(Item 02 SAMAM 063/2016).
Lote 5: DOSADOR QUIMICO. Colagenase tipo II. Liofilizada. Isolada de Clostridium histolyticum. Própria para cultura de células. Sem vermelho fenol. Com atividade superior a 125 unidades/mg. Frasco com um grama. Marca GIBCO (catálogo ****) ou similar. (Item 03 SAMAM 063/2016).
Lote 6: DOSADOR QUIMICO. Colagenase tipo III. Liofilizada. Isolada de Clostridium histolyticum. Própria para cultura de células. Purificado por cromatografia. Com igual ou superior 250 CDU/mg. Frasco com **** unidades. Marca Sigma (****) ou similar. (Item 04 SAMAM 063/2016).
Lote 7: DOSADOR QUIMICO. Colagenase tipo IV. Liofilizada. Isolada de Clostridium histolyticum. Própria para cultura de células. Sem vermelho fenol. Com atividade superior a 160 unidades/mg. Frasco com um grama. Marca GIBCO (catálogo ****) ou similar. (Item 05 SAMAM 063/2016).
Lote 8: DOSADOR QUIMICO. Accutase. Reagente para dissociação de células-tronco. Frasco com 100mL. Marca GIBCO (catálogo ****) ou similar. (Item 06 SAMAM 063/2016).
Lote 9: DOSADOR QUIMICO. Fitohemaglutinina forma M. Frasco com 10mL. Marca Gibco (****) ou similar. (Item 07 SAMAM 063/2016).
Lote 10: DOSADOR QUIMICO. Sulfato de Gentamicina, Grau USP, frasco com 25g. Marca Merck (****) ou similar. (Item 08 SAMAM 063/2016).
Lote 11: DOSADOR QUIMICO. Sulfato de Estreptomicina, frasco com 50G. Marca Merck (****) ou similar. (Item 09 SAMAM 063/2016).
Lote 12: DOSADOR QUIMICO. Anfotericina B, obtida de Streptomyces sp. Adequado para cultura de células. Frasco com 1g. Marca Sigma (****) ou similar. (Item 10 SAMAM 063/2016).
Lote 13: DOSADOR QUIMICO. Tripsina (1:250). Liofilizada. Sem vermelho fenol e EDTA. 250 vezes concentrada. Com baixo nível de endotoxinas. Próprio para cultura de células aderentes. Frasco com 100g. Marca GIBCO (catálogo ****) ou similar. (Item 11 SAMAM 063/2016).
Lote 14: DOSADOR QUIMICO. Solução de Ficoll. Própria para o isolamento de células brancas de amostras de sangue. Densidade de **** g/mL. Estéril. Frasco com 100mL. Marca SIGMA (catálogo ****) ou similar. (Item 12 SAMAM 063/2016).
Lote 15: DOSADOR QUIMICO. Pepsina A. De mucosa gástrica suína. Liofilizada. Com 2,500 unidades/mg. Frasco com 1g. Marca SIGMA (catálogo ****) ou similar. (Item 13 SAMAM 063/2016).
Lote 16: DOSADOR QUIMICO. Solução de TBE concentrada 10 vezes. Compatível com géis de agarose e poliacrilamida. Estéril. Composta de 1 M Tris, 0.9 M de ácido bórico e 0.01 M EDTA. Frasco com 1L. Marca INVITROGEN (catálogo ****) ou similar. (Item 14 SAMAM 063/2016).
Lote 17: DOSADOR QUIMICO. Solução estabilizadora de RNA, RNAlater. Permite a estabilidade do RNA por 1 dia a 37¨C, uma semana a 25¨C, um mês a 4¨C e indefinido a -20¨C. Em frasco de 500mL. Marca AMBION (catálogo ****) ou similar. (Item 15 SAMAM 063/2016).
Lote 18: DOSADOR QUIMICO. Solução de PBS (phosphate buffered saline) 1X. pH 7.4. Sem cálcio e magnésio. Sem vermelho fenol e piruvato de sódio. Estéril. Frasco com 500mL. Marca GIBCO (catálogo ****) ou similar. (Item 16 SAMAM 063/2016).
Lote 19: DOSADOR QUIMICO. Solução de dispase II (1U/mL). Em DMEM/F12. Frasco com 100ml. Marca STEMCELL (catálogo ****) ou similar. (Item 17 SAMAM 063/2016).
Lote 20: DOSADOR QUIMICO. Solução de Colcemid tipo Karyomax, em HBSS. Frasco com 10 ml. Marca GIBCO (catálogo ****) ou similar. (Item 18 SAMAM 063/2016).
Lote 21: DOSADOR QUIMICO. Glicerol. Para Biologia molecular, pureza de 99%. Frasco com 1L. Marca Sigma (catálogo ****) ou similar. (Item 19 SAMAM 063/2016).
Lote 22: DOSADOR QUIMICO. Oligonucleotideo para genotipagem do gene CYP2D6 DPKup 5 -GTTATCCCAGAAGGCTTTGCAGGCTTCA-3 , escala de síntese 200nmol (Item 01 SAPAR 003/2016).
Lote 23: DOSADOR QUIMICO. Oligonucleotideo, escala de síntese de 200nmol, para genotipagem do gene CYP2D6 DPKlow 5 -GCCGACTGAGCCCTGGGAGGTAGGTA-3 (Item 02 SAPAR 003/2016).
Lote 24: DOSADOR QUIMICO. Oligonucleotideo, escala de síntese, para genotipagem do gene CYP2D6 2D6dupl-F 5 -CCTGGGAAGGCCCCATGGAAG-3 (Item 03 SAPAR 003/2016).
Lote 25: DOSADOR QUIMICO. Oligonucleotideo, escala de síntese de 200nmol, para genotipagem do gene CYP2D6 2D6dupl-R 5 -CAGTTACGGCAGTGGTCAGCT-3 (Item 04 SAPAR 003/2016).
Lote 26: DOSADOR QUIMICO. Oligonucleotideo ,escala de síntese de 200nmol, para genotipagem do gene CYP2D6 5 2D6dup 5 -GCCACCATGGTGTCTTTGCTTTCCTGG-3 (Item 05 SAPAR 003/2016).
Lote 27: DOSADOR QUIMICO. Oligonucleotideo, escala de síntese de 200nmol, para genotipagem do gene CYP2D6 3 2D6dup 5 -GGTTTCTTGGCCCGCTGTCCCCACTC-3 (Item 06 SAPAR 003/2016).
Lote 28: DOSADOR QUIMICO. Oligonucleotideo para genotipagem das Variantes de P. vivax: PVCSP1: 5 AGGCAGAGGACTTGGTGAGA 3 . Na escala inicial de 200 nMol. Marca Invitrogen. (Item 07 SAPAR 003/2016).
Lote 29: DOSADOR QUIMICO. Oligonucleotideo para genotipagem das Variantes de P. vivax: PVCSP2: 5 CCACAGGTTACACTGCATGG 3 . Na escala inicial de 200 nMol (Item 08 SAPAR 003/2016).
Lote 30: DOSADOR QUIMICO. GelRed **** em agua 0,5 mL. Marca Invitrogen. (Item 09 SAPAR 003/2016).
Lote 31: DOSADOR QUIMICO. Enzima Platinum Taq DNA polimerase (500 U) - (5U/uL) High Fidelity. Marca Invitrogen. (Item 10 SAPAR 003/2016).
Lote 32: DOSADOR QUIMICO. Ion Plus Fragment Library Adapters (Item 01 SAPAR 032/2016).
Lote 33: DOSADOR QUIMICO. Ion Xpress Barcode Adaptors **** Kit (Item 02 SAPAR 032/2016).
Lote 34: DOSADOR QUIMICO. Ion Plus Library Kit for AB Library Builder (Item 03 SAPAR 032/2016).
Lote 35: DOSADOR QUIMICO. Ion Xpress Plus Library Kit for AB Library Builder (Item 04 SAPAR 032/2016).
Lote 36: DOSADOR QUIMICO. Ion Library TaqMan Quantitation Kit (Item 05 SAPAR 032/2016).
Lote 37: DOSADOR QUIMICO. Ion PGM Hi-Q OT2 Kit (Item 06 SAPAR 032/2016).
Lote 38: DOSADOR QUIMICO. Ion PGM HI-Q Sequencing Kit (Item 07 SAPAR 032/2016).
Lote 39: DOSADOR QUIMICO. Ion PGM Hi-Q Wash 2 Bottle Kit (Item 08 SAPAR 032/2016).
Lote 40: DOSADOR QUIMICO. Ion Sphere Quality Control Kit (Item 09 SAPAR 032/2016).
Lote 41: DOSADOR QUIMICO. Ion CHIP 318 v2 pct 4 (Item 10 SAPAR 032/2016).
Lote 42: DOSADOR QUIMICO. E-Gel® SizeSelect Agarose Gels, 2% (Item 11 SAPAR 032/2016).
Lote 43: DOSADOR QUIMICO. Dynabeads® M-270 Streptavidin (Item 12 SAPAR 032/2016).
Lote 44: DOSADOR QUIMICO. OLIGONUCLEOTIDEO: JW63- 5 -GCA CCT TTC GGA CCT CAA CAA CCG-3 . ESCALA DE SÍNTESE DE 200 NMOL; BASES PURIFICADAS POR RP-OPC, LIOFILIZADAS. PARA IDENTIFICAÇÃO DO FRAGMENTO GÊNICO B1 POR NESTED-PCR (1º REAÇÃO). ACONDICIONAMENTO: FRASCO APROPRIADO COM TAMPA DE ROSCA; ROTULAGEM: NUMERO DE LOTE, DATA DE FABRICACAO, VALIDADE, COMPOSICAO E PROCEDENCIA; CERTIFICACAO: COM CERTIFICADO DE ANALISE; VALIDADE: MINIMA DE UM ANO A PARTIR DA DATA DE ENTREGA; UNIDADE DE FORNECIMENTO: FRASCO COM 200 NMOLES (Item 01 SAPAR 055/2016).
Lote 45: DOSADOR QUIMICO. OLIGONUCLEOTIDEO: JW62- 5 - TTC TCG CCT CAT TTC TGG GTC TAC-3 - . FRASCO COM ESCALA INICIAL DE 200 NMOL. BASES PURIFICADAS POR RP-OPC , LIOFILIZADAS; PARA IDENTIFICAÇÃO DO FRAGMENTO GÊNICO B1 POR NESTED-PCR (1º REAÇÃO). ACONDICIONAMENTO: FRASCO APROPRIADO COM TAMPA DE ROSCA; ROTULAGEM: NUMERO DE LOTE, DATA DE FABRICACAO, VALIDADE, COMPOSICAO E PROCEDENCIA; CERTIFICACAO: COM CERTIFICADO DE ANALISE; VALIDADE: MINIMA DE UM ANO A PARTIR DA DATA DE ENTREGA; UNIDADE DE FORNECIMENTO: FRASCO COM 200 NMOLES (Item 02 SAPAR 055/2016).
Lote 46: DOSADOR QUIMICO. OLIGONUCLEOTIDEO: B22- 5 - AAC GGG CGA GTA GCA CCT GAG GAG A-3 - ESCALA INICIAL DE 200 NMOL, BASES PURIFICADAS POR RP-OPC, LIOFILIZADAS. PARA IDENTIFICAÇÃO DO FRAGMENTO GÊNICO B1 POR NESTED-PCR (2º REAÇÃO). ACONDICIONAMENTO: FRASCO APROPRIADO COM TAMPA DE ROSCA; ROTULAGEM: NUMERO DE LOTE, DATA DE FABRICACAO, VALIDADE, COMPOSICAO E PROCEDENCIA; CERTIFICACAO: COM CERTIFICADO DE ANALISE; VALIDADE: MINIMA DE UM ANO A PARTIR DA DATA DE ENTREGA; UNIDADE DE FORNECIMENTO: FRASCO COM 200 NMOLES (Item 03 SAPAR 055/2016).
Lote 47: DOSADOR QUIMICO. OLIGONUCLEOTIDEO: B23 -5 -TGG GTC TAC GTC GAT GGC ATG ACA ACT-3 - ESCALA INICIAL DE 200 NMOL. BASES PURIFICADAS POR RP-OPC, LIOFILIZADAS. PARA IDENTIFICAÇÃO DO FRAGMENTO GÊNICO B1 POR NESTED-PCR (2º REAÇÃO). ACONDICIONAMENTO: FRASCO APROPRIADO COM TAMPA DE ROSCA; ROTULAGEM: NUMERO DE LOTE, DATA DE FABRICACAO, VALIDADE, COMPOSICAO E PROCEDENCIA; CERTIFICACAO: COM CERTIFICADO DE ANALISE; VALIDADE: MINIMA DE UM ANO A PARTIR DA DATA DE ENTREGA; UNIDADE DE FORNECIMENTO: FRASCO COM 200 NMOLES (Item 04 SAPAR 055/2016).
Lote 48: DOSADOR QUIMICO. OLIGONUCLEOTIDEO: TOX4- 5 - CGC TGC AGG GAG GAA GAC GAA AGT TG 3 - ESCALA INICIAL DE 200 NMOL. BASES PURIFICADAS POR RP-OPC, LIOFILIZADAS. PARA IDENTIFICAÇÃO DO FRAGMENTO GÊNICO REP-529 PB POR PCR. ACONDICIONAMENTO: FRASCO APROPRIADO COM TAMPA DE ROSCA; ROTULAGEM: NUMERO DE LOTE, DATA DE FABRICACAO, VALIDADE, COMPOSICAO E PROCEDENCIA; COM CERTIFICADO DE ANALISE; VALIDADE: MINIMA DE UM ANO A PARTIR DA DATA DE ENTREGA; UNIDADE DE FORNECIMENTO: FRASCO COM 200 NMOLES. (Item 05 SAPAR 055/2016).
Lote 49: DOSADOR QUIMICO. OLIGONUCLEOTIDEO: TOX5 -5 CGC TGC AGA CAC AGT GCA TCT GGA TT 3 - ESCALA INICIAL DE 200 NMOL. BASES PURIFICADAS POR RP-OPC, LIOFILIZADAS. PARA IDENTIFICAÇÃO DO FRAGMENTO GÊNICO REP-529-PB POR PCR. ACONDICIONAMENTO: FRASCO APROPRIADO COM TAMPA DE ROSCA; ROTULAGEM: NUMERO DE LOTE, DATA DE FABRICACAO, VALIDADE, COMPOSICAO E PROCEDENCIA; CERTIFICACAO: COM CERTIFICADO DE ANALISE; VALIDADE: MINIMA DE UM ANO A PARTIR DA DATA DE ENTREGA; UNIDADE DE FORNECIMENTO: FRASCO COM 200 NMOLES (Item 06 SAPAR 055/2016).
Lote 50: DOSADOR QUIMICO. ANTICORPO ANTI IGG DE GALINHA (MOLÉCULA TOTAL), CADEIA LEVE E PESADA, PRODUZIDA EM CARNEIRO OU COELHO, CONJUGADO À FITC. PARA REAÇÃO DE IMUNOFLUORESCÊNCIA INDIRETA. FRASCO COM 1 ML (Item 07 SAPAR 055/2016).
Lote 51: DOSADOR QUIMICO. ANTICORPO ANTI IGG SUINO (MOLÉCULA TOTAL), CADEIA LEVE E PESADA, PRODUZIDA EM CARNEIRO, CONJUGADO À FITC. PARA REAÇÃO DE IMUNOFLUORESCÊNCIA INDIRETA. FRASCO COM 1 ML (Item 08 SAPAR 055/2016).
Lote 52: DOSADOR QUIMICO. Primer **** Forward Out (1) para Diagnóstico de Malária Humana: 5´ GGT TTC CTT CTC AAA AAA TAA AG 3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 01 SAPAR 062/2016).
Lote 53: DOSADOR QUIMICO. Primer 12E 2R1 reverse out (1) para Diagnóstico de Malária Humana: 5´ TCT ACA TGT GCT TGA GTT TCG 3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 02 SAPAR 062/2016).
Lote 54: DOSADOR QUIMICO. Primer 2E12F Forward In (2) para Diagnóstico de Malária Humana: 5´ GTA TTA TCC GCT GCC GTT TTT GCG 3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 03 SAPAR 062/2016).
Lote 55: DOSADOR QUIMICO. Primer 2E12R Reverse In (2) para Diagnóstico de Malária Humana: 5´ CTA CAC AAG TTA TTA TTA AAT GCG GAA 3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 04 SAPAR 062/2016).
Lote 56: DOSADOR QUIMICO. Primer 2E2F Forward Out (1) para o Diagnóstico de Malária Humana: 5´ TTC CGC ATT TAA TAA TAA CTT GTG 3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 05 SAPAR 062/2016).
Lote 57: DOSADOR QUIMICO. Primer 2E2R1 Reverse Out (1) para o Diagnóstico de Malária Humana: 5´ GGC AAT GTG TGG CGG CTT C 3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 06 SAPAR 062/2016).
Lote 58: DOSADOR QUIMICO. Primer 2E2F1 Forward In (2) para o Diagnóstico de Malária Humana: 5´ CGA AAC TCA AGC ACA TGT AGA 3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 07 SAPAR 062/2016).
Lote 59: DOSADOR QUIMICO. Primer 2E2R Reverse In (2) para o Diagnóstico de Malária Humana: 5´ CTT CGT GGT GTG CGG CTG 3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 08 SAPAR 062/2016).
Lote 60: DOSADOR QUIMICO. Primer 228F Forward (1) para o Diagnóstico de Malária Humana: 5´ AGA CAA GCT ACC AAA GAT GCA GGT G 3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 09 SAPAR 062/2016).
Lote 61: DOSADOR QUIMICO. Primer 228R Reverse (1) (2) para o Diagnóstico de Malária Humana: 5´ TAA ATG TGT ATC TCC TGA GGT AGC 3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 10 SAPAR 062/2016).
Lote 62: DOSADOR QUIMICO. Primer **** Forward 1 (2) para o diagnóstico de Malária Humana: 5´ CCA TTG CTG GTT TAA ATG TTT TAA G 3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 11 SAPAR 062/2016).
Lote 63: DOSADOR QUIMICO. Primer 230F Forward (1) (2) para o Diagnóstico de Malária Humana: 5´ TAT GAA CGC AAT TTA AGT GAG GCA G 3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 12 SAPAR 062/2016).
Lote 64: DOSADOR QUIMICO. Primer 230R Reverse (1) para o Diagnóstico de Malária Humana: 5´ TAT CCA ATC CTT CCT TTG CAA CAC C 3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 13 SAPAR 062/2016).
Lote 65: DOSADOR QUIMICO. Primer **** Reverse 1 (2) para o Diagnóstico de Malária Humana: 5´ GTG TGA GTC CAT ATA TTT TTA AGA TC 3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 14 SAPAR 062/2016).

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.