Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Pregão Eletrônico Edital: 33/2016- Juiz De Fora Mg |

Atualizado em 20/09/2016. Acesse também licitações mais recentes e baixe os editais.

20/09/2016 - MG ( JUIZ DE FORA ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/CENTRO NACIONAL DE PESQUISA DE GADO DE LEITE (UASG: 135015)

Aquisição de materiais para laboratórios.

Lote 1: LABORATORIO DIDATICO MOVEL. 2-Phenethyl Acetate 99%, 250 mL Marca de referência: Sigma Aldrich Código de referência: ****.
Lote 2: LABORATORIO DIDATICO MOVEL. ÁCIDO METAFOSFÓRICO PA EM BASTÕES ONU **** SOLIDO CORROSIVO, ÁCIDO, INORGÂNICO, N.E (QUANTIDADE LIMITADA) 8III FRASCO 100 G. MARCA DE REFERÊNCIA: VETEC, CÓDIGO ****.
Lote 3: LABORATORIO DIDATICO MOVEL. ÁCIDO NALIDÍXICO (ÁCIDO NALIDÍXICO PUREX). MARCA DE REFERÊNCIA: INLAB, CÓDIGO: ****, FRASCO COM 50G ****.
Lote 4: LABORATORIO DIDATICO MOVEL. AÇÚCAR LACTOSE PARA USO EM MICROBIOLOGIA, FRASCO COM 100 GRAMAS. MARCAS DE REFERÊNCIA SIGMA ALDRICH, CÓDIGO: ****.
Lote 5: LABORATORIO DIDATICO MOVEL. ÁGAR BP (BAIRD-PARKER AGAR), FRASCO COM 500 GRAMAS. MARCA DE REFERÊNCIA: MERCK, CÓDIGO CATÁLOGO ****.
Lote 6: LABORATORIO DIDATICO MOVEL. ÁGAR RAMBACH (RAMBACH AGAR), CAIXA COM 4 FRASCOS. MARCA DE REFERÊNCIA MERCK, CÓDIGO CATÁLOGO ****.
Lote 7: LABORATORIO DIDATICO MOVEL. AGAROSE, ULTRAPURE, FRASCO COM 100 GRAMAS. MARCA DE REFERÊNCIA INVITROGEN, CÓDIGO ****.
Lote 8: LABORATORIO DIDATICO MOVEL. ÁGUA PEPTONADA TAMPONADA (BUFFERED PEPTONE WATER). FRASCO COM 500 GRAMAS. MARCA DE REFERÊNCIA: OXOID, CÓDIGO ****.
Lote 9: LABORATORIO DIDATICO MOVEL. AGULHA HIPODÉRMICA, MATERIAL AÇO INOXIDÁVEL SILICONIZADO, DIMENSÃO 21 G X 1 1/2´, TIPO PONTA BISEL CURTO TRIFACETADO, TIPO CONEXÃO CONECTOR LUER LOCK EM PLÁSTICO, TIPO FIXAÇÃO PROTETOR PLÁSTICO, CARACTERÍSTICA ADICIONAL COM SISTEMA SEGURANÇA SEGUNDO NR/32, TIPO USO ESTÉRIL, DESCARTÁVEL, EMBALAGEM INDIVIDUAL. CAIXA COM 100 UNIDADES..
Lote 10: LABORATORIO DIDATICO MOVEL. AGULHA PARA COLETA MÚLTIPLA DE SANGUE A VÁCUO, PARA ANÁLISES CLÍNICAS, CANHÃO DE COR VERDE, COM BISEL TRIFACETADO SILICONIZADA, ESTERILIZADA ÓXIDO DE ETILENO. EMBALAGEM UNITÁRIA EM PLÁSTICO COM LACRE DE SEGURANÇA EM PAPEL, CONTENDO UM CALIBRE DA AGULHA. MEDIDAS DA AGULHA: 25X8 MM (21G1), TIPO VACUTAINER BRAND BLOOD COLLECTION.
Lote 11: LABORATORIO DIDATICO MOVEL. ALÇA DE PLATINA CALIBRADA CAPACIDADE 10 UL.
Lote 12: LABORATORIO DIDATICO MOVEL. ALÇA PLATINA NÃO CALIBRADA PARA USO EM BACTERIOLOGIA, COMPRIMENTO MÍNIMO DE 50 MM, MARCA DE REFERÊNCIA: LABORCLIN.
Lote 13: LABORATORIO DIDATICO MOVEL. ALÇAS BACTERIOLÓGICAS (LOOP 1 UL), DESCARTÁVEIS, ESTÉREIS DE 1 µL. CAIXA COM 100 UNIDADES. MARCA DE REFERÊNCIA: INLAB, CÓDIGO ****. AMAR (EMBALADAS INDIVIDUALMENTE)..
Lote 14: LABORATORIO DIDATICO MOVEL. ÁLCOOL ETÍLICO ABSOLUTO. REAGENTE PARA BIOLOGIA MOLECULAR, LIVRE DE DNASE E RNASE, COM ALTO GRAU DE PUREZA. MARCA DE REFERÊNCIA: MERCK, CÓDIGO ****.
Lote 15: LABORATORIO DIDATICO MOVEL. ÁLCOOL ETÍLICO HIDRATADO, 92,8¨ I.N.P.M., FRASCO COM 1 LITRO.
Lote 16: LABORATORIO DIDATICO MOVEL. BÉQUER DE VIDRO BOROSSILICATO, FORMA ALTA, 100ML..
Lote 17: LABORATORIO DIDATICO MOVEL. BALÃO DE REAÇÃO DE 100 ML COM BOCA ESMERILHADA (****) FUNDO CHATO.
Lote 18: LABORATORIO DIDATICO MOVEL. BALÃO DE REAÇÃO DE 25 ML COM BOCA ESMERILHADA (****) FUNDO CHATO.
Lote 19: LABORATORIO DIDATICO MOVEL. BALÃO DE REAÇÃO DE 50 ML COM BOCA ESMERILHADA (****) FUNDO CHATO.
Lote 20: LABORATORIO DIDATICO MOVEL. BASTÃO DE VIDRO DE 8MM X 300MM. MARCA DE REFERÊNCIA: UNIGLAS.
Lote 21: LABORATORIO DIDATICO MOVEL. BÉQUER DE VIDRO BOROSSILICATO, 1 LITRO.
Lote 22: LABORATORIO DIDATICO MOVEL. BÉQUER DE VIDRO BOROSSILICATO, 150 ML.
Lote 23: LABORATORIO DIDATICO MOVEL. BÉQUER DE VIDRO BOROSSILICATO, 2 LITROS.
Lote 24: LABORATORIO DIDATICO MOVEL. BÉQUER DE VIDRO BOROSSILICATO, 250 ML.
Lote 25: LABORATORIO DIDATICO MOVEL. BÉQUER DE VIDRO BOROSSILICATO, 500 ML.
Lote 26: LABORATORIO DIDATICO MOVEL. CAIXA LABORATÓRIO, MATERIAL POLICARBONATO, CAPACIDADE 96 TUBOS, VOLUME PARA TUBOS ATÉ 2ML.
Lote 27: LABORATORIO DIDATICO MOVEL. CAIXA LABORATÓRIO, MATERIAL POLIPROPILENO, CAPACIDADE 96 PONTEIRAS, VOLUME PARA PONTEIRA ****.
Lote 28: LABORATORIO DIDATICO MOVEL. CAIXA LABORATÓRIO, MATERIAL POLIPROPILENO, CAPACIDADE 96 PONTEIRAS, VOLUME PARA PONTEIRA 10UL.
Lote 29: LABORATORIO DIDATICO MOVEL. CAIXA LABORATÓRIO, MATERIAL POLIPROPILENO, CAPACIDADE 96 PONTEIRAS, VOLUME PARA PONTEIRA 200UL.
Lote 30: LABORATORIO DIDATICO MOVEL. CAIXA LABORATÓRIO, MATERIAL POLIPROPILENO, CAPACIDADE 96 PONTEIRAS, VOLUME PARA PONTEIRA 200UL.
Lote 31: LABORATORIO DIDATICO MOVEL. CAIXA LABORATÓRIO, MATERIAL POLIPROPILENO, CAPACIDADE 96 TUBOS, VOLUME PARA TUBOS ATÉ 0,2ML.
Lote 32: LABORATORIO DIDATICO MOVEL. CAIXA, MATERIAL PAPELÃO ONDULADO DUPLEX, COMPRIMENTO 290, LARGURA 95, ALTURA 86, CARACTERÍSTICAS ADICIONAIS SUPERFÍCIE EXTERNA LISA, 4 DIVISÕES, INTERNAMENTE, COR BRANCA, APLICAÇÃO ACONDICIONAR LÂMINAS HISTOLÓGICAS, MARCA REFERENCIA: CRALPLAST..
Lote 33: LABORATORIO DIDATICO MOVEL. CALDO BHI (BRAIN HEART INFUSION BROTH), FRASCO COM 500 GRAMAS.. MARCA DE REFERÊNCIA: OXOID, CÓDIGO ****.
Lote 34: LABORATORIO DIDATICO MOVEL. CALDO RAPPAPORT (RAPPAPORT VASSILIADIS SOYA PEP BROTH), FRASCO COM 500 GRAMAS. MARCA DE REFERÊNCIA: OXOID, CÓDIGO ****.
Lote 35: LABORATORIO DIDATICO MOVEL. CALDO TODD HEWITT (TODD-HEWITT BROTH), FRASCO COM 500 GRAMAS. MARCA DE REFERÊNCIA: OXOID, CÓDIGO ****.
Lote 36: LABORATORIO DIDATICO MOVEL. CÂMARA DE NEWBAUER.
Lote 37: LABORATORIO DIDATICO MOVEL. CLORETO DE MAGNÉSIO, P.A., 1 KG.
Lote 38: LABORATORIO DIDATICO MOVEL. CLORO 12% (HIPOCLORITO DE SÓDIO 10 A 12%). GALÃO DE 5 LITROS. MARCA DE REFERÊNCIA SULFAL, CÓDIGO ****.
Lote 39: LABORATORIO DIDATICO MOVEL. CONDENSADOR DE REFLUXO EM BOROSILICATO COM BOCA ESMERILHADA 30 CM (****).
Lote 40: LABORATORIO DIDATICO MOVEL. CONJUNTO DE REAGENTE PARA DIAGNÓSTICO CLÍNICO, TIPO CONJUNTO COMPLETO PARA AUTOMAÇÃO, TIPO DE ANÁLISE QUANTITATIVO DE TRIGLICERÍDEOS, MÉTODO ENZIMÁTICO COLORIMÉTRICO DE PONTO FINAL, APRESENTAÇÃO TESTE. FRASCO COM 500 ML. MARCA DE REFERÊNCIA LABTEST, CÓDIGO ****.
Lote 41: LABORATORIO DIDATICO MOVEL. CORANTE PARA GEL DE DNA - SYBR SAFE DNA GEL STAIN, FRASCO COM 400UL. MARCA DE REFERÊNCIA THERMO FISHER, CÓDIGO ****.
Lote 42: LABORATORIO DIDATICO MOVEL. CORANTE, TIPO CONJUNTO COLORAÇÃO ÁCIDO PERIÓDICO / SCHIFF, ASPECTO FÍSICO LÍQUIDO, COMPOSIÇÃO SOLUÇÃO ÁCIDO PERIÓDICO, REAGENTE SCHIFF, COMPONENTES ADICIONAIS HEMATOXILINA, PRONTO PARA USO, FRASCO DE 500 ML..
Lote 43: LABORATORIO DIDATICO MOVEL. CORANTE, TIPO EOSINA AMARELADA Y, ASPECTO FÍSICO PÓ, CARACTERÍSTICAS ADICIONAIS CI ****, FRASCO COM 25G. MARCA REFERENCIA PROQUIMIOS..
Lote 44: LABORATORIO DIDATICO MOVEL. CORANTE, TIPO HEMATOXILINA, ASPECTO FÍSICO PÓ, CARACTERÍSTICAS ADICIONAIS CI ****, FRASCO CONTENDO 25G..
Lote 45: LABORATORIO DIDATICO MOVEL. CORANTE, TIPO* CORANTE DE GIEMSA EOSINA AZUL DE METILENO, ASPECTO FÍSICO* PÓ, FRASCO CONTENDO 25G, MARCA REFERÊNCIA MERCK.
Lote 46: LABORATORIO DIDATICO MOVEL. CRIOTUBOS 2 ML COM ROSCA INTERNA (MARCA CORNING, TPP OU KASVI).
Lote 47: LABORATORIO DIDATICO MOVEL. DESSECADOR EM VIDRO, COM FUNDO E TAMPA COM LUVA, DIÂMETRO DE 250 MM, LUVA 55/38, NÃO ACOMPANHA PLACA CERÂMICA PERFURADA. MARCA DE REFERÊNCIA: UNIGLAS.
Lote 48: LABORATORIO DIDATICO MOVEL. DETERGENTE ALCALINO FINALIDADE: LIMPEZA DE IMERSÃO DE VIDRARIAS LABORATORIAIS, GALÃO DE 5 LITROS. MARCA DE REFERÊNCIA: SPARTAN SC-200.
Lote 49: LABORATORIO DIDATICO MOVEL. DMPBS - TAMPAO FOSFATO SALINO MODIFICADO POR DULBECCO. BOLSA DE 1 LITRO..
Lote 50: 5 A 75%); VAZÃO: 120 LITROS/HORA; GRAU DE FILTRAÇÃO: 5 MICRA; DIMENSIONAIS: ALTURA: 248 MM; DIÂMETRO EXTERNO: 70 MM; DIÂMETRO INTERNO: 26MM..
Lote 51: 15 A
Lote 52: 5 A
Lote 53: LABORATORIO DIDATICO MOVEL. ELETRODO PARA PHMETRO BLINDADO.
Lote 54: LABORATORIO DIDATICO MOVEL. ENZIMA DE RESTRIÇÃO CFR9I (ISOESQUISÔMERO DA SMAI, NÃO SERVE A SMAI). FRASCO COM **** UNIDADES..
Lote 55: LABORATORIO DIDATICO MOVEL. ESPÁTULA CANALETA EM AÇO INOX.
Lote 56: LABORATORIO DIDATICO MOVEL. ESPÁTULA DE INOX TIPO CANALETA COM 18 CM DE COMPRIMENTO. MARCA DE REFERÊNCIA: METALIC.
Lote 57: LABORATORIO DIDATICO MOVEL. ESPÁTULA DUPLA COM MICRO-COLHER EM ARAME DE AÇO INOX.
Lote 58: LABORATORIO DIDATICO MOVEL. ESPÁTULA EM AÇO INOX, COM CABO DE MADEIRA. DIMENSÕES 22 X 200MM. MARCA DE REFERÊNCIA: METALIC.
Lote 59: LABORATORIO DIDATICO MOVEL. FILTRO DE SERINGA 25 MM X 0,22 MICRAS CELULOSE. PACOTE COM 50 UNIDADES..
Lote 60: LABORATORIO DIDATICO MOVEL. FILTRO PARA SERINGA 0.22 µM (33 MM DE DIAMETRO) ESTÉRIL EMBALADOS INDIVIDUALMENTE - CAIXA COM 50 UNIDADES - REFERÊNCIA: **** - JET BIOFIL.
Lote 61: LABORATORIO DIDATICO MOVEL. FITA ADESIVA AUTOCLAVE, MATERIAL PAPEL CREPE, TIPO MONOFACE, COM INDICADOR TÉRMICO, APLICAÇÃO FECHAMENTO DE PACOTES DE PAPEL E DE PANO QUE SERÃO ESTERILIZADOS EM AUTOCLAVE. ROLO COM 19 MM X 30 M..
Lote 62: LABORATORIO DIDATICO MOVEL. FLUIDO DE CO2 PARA FYRITE: 0-20% (USADO PARA INDICAR A SATURAÇÃO DE CO2 EM ESTUFAS INCUBADORAS). MARCA DE REFERÊNCIA: BACHARACH..
Lote 63: LABORATORIO DIDATICO MOVEL. FLUIDO DE O2 PARA FYRITE: 0-60% (USADO PARA INDICAR A SATURAÇÃO DE O2 EM ESTUFAS INCUBADORAS). MARCA DE REFERÊNCIA: BACHARACH.
Lote 64: LABORATORIO DIDATICO MOVEL. FRASCO - GARRAFA PARA CULTURA CELULAR, ÁREA 25CM2, MATERIAL POLIESTIRENO, TRATAMENTO SUPERFICIAL. MARCA DE REFERÊNCIA: CORNING.
Lote 65: LABORATORIO DIDATICO MOVEL. FRASCO - GARRAFA PARA CULTURA CELULAR, ÁREA 75CM2, MATERIAL POLIESTIRENO, TRATAMENTO SUPERFICIAL. MARCA DE REFERÊNCIA: CORNING.
Lote 66: LABORATORIO DIDATICO MOVEL. FRASCO DE BOROSILICATO COM TAMPA ROSQUEÁVEL - CAPACIDADE 100 ML.
Lote 67: LABORATORIO DIDATICO MOVEL. FRASCO DE REAGENTE DE VIDRO C/ TAMPA DE ROSCA, 500 ML.
Lote 68: LABORATORIO DIDATICO MOVEL. FRASCO DE REAGENTE DE VIDRO C/ TAMPA DE ROSCA, 500 ML.
Lote 69: LABORATORIO DIDATICO MOVEL. FRASCO EM VIDRO BOROSILICATO TRANSPARENTE COM TAMPA ROSQUEÁVEL E ANEL CORTA-PINGOS, **** ML, TIPO SCHOTT.
Lote 70: LABORATORIO DIDATICO MOVEL. FRASCO EM VIDRO BOROSILICATO TRANSPARENTE COM TAMPA ROSQUEÁVEL E ANEL CORTA-PINGOS, 250 ML, TIPO SCHOTT.
Lote 71: LABORATORIO DIDATICO MOVEL. FRASCO EM VIDRO BOROSILICATO TRANSPARENTE COM TAMPA ROSQUEÁVEL E ANEL CORTA-PINGOS, 500 ML, TIPO SCHOTT.
Lote 72: LABORATORIO DIDATICO MOVEL. FRASCO LABORATÓRIO, TIPO REAGENTE, MATERIAL VIDRO, CAPACIDADE 100.
Lote 73: LABORATORIO DIDATICO MOVEL. FRASCO LABORATÓRIO, TIPO REAGENTE, MATERIAL VIDRO, CAPACIDADE 250.
Lote 74: LABORATORIO DIDATICO MOVEL. FRASCO LABORATÓRIO, TIPO REAGENTE, MATERIAL VIDRO, CAPACIDADE 500ML.
Lote 75: LABORATORIO DIDATICO MOVEL. FRASCO PARA AMOSTRAS: ALTURA 13 CM, DIÂMETRO 55MM, CAPACIDADE 250 ML. COR TRANSPARENTE (CRISTAL). MATERIAL PLÁSTICO. TAMPA DE ROSCA LACRE. MARCA REFERÊNCIA: NALGON..
Lote 76: LABORATORIO DIDATICO MOVEL. FRASCO REAGENTE BOROSILICATO INCOLOR GRADUADO COM TAMPA ROSCA AZUL - VOLUME 1 L.
Lote 77: LABORATORIO DIDATICO MOVEL. FRASCO REAGENTE BOROSILICATO INCOLOR GRADUADO COM TAMPA ROSCA AZUL AMBAR - VOLUME 500 ML.
Lote 78: LABORATORIO DIDATICO MOVEL. FRASCO REAGENTE BOROSILICATO INCOLOR GRADUADO COM TAMPA ROSCA AZUL- VOLUME 500 ML.
Lote 79: LABORATORIO DIDATICO MOVEL. GAZE COMPRESSA, TECIDO 100% ALGODÃO, 13 FIOS/CM2, COR BRANCA, ISENTA DE IMPUREZAS, 8 CAMADAS, LARGURA 7,50 CM (L) X 7,50 CM (C), 5 DOBRAS, DESCARTÁVEL. PACOTE COM 500 UNIDADES..
Lote 80: LABORATORIO DIDATICO MOVEL. GAZE HIDRÓFILA TIPO QUEIJO ROLO 91M X 91CM.
Lote 81: LABORATORIO DIDATICO MOVEL. GELRED 0,5ML EM ÁGUA ****. MARCA DE REFERÊNCIA: BIOTIUM, CÓDIGO ****.
Lote 82: LABORATORIO DIDATICO MOVEL. GEMA DE OVO COM TELURITO DE POTÁSSIO. FRASCO COM 100 ML. MARCA DE REFERÊNCIA: LABORCLIN, CÓDIGO ****.
Lote 83: LABORATORIO DIDATICO MOVEL. IMPROM-II REVERSE TRANSCRIPTION SYSTEM 100 REACTIONS MARCA DE REFERÊNCIA: PROMEGA CÓDIGO DE REFERÊNCIA: ****.
Lote 84: LABORATORIO DIDATICO MOVEL. KIT DE AMPLIFICAÇÃO DE DNA: ILLUSTRA SINGLE CELL GENOMIPHI DNA AMPLIFICATION PARA 25 REAÇÕES, MÉTODO MDA. MARCA DE REFERÊNCIA: GE LIFE SCIENCE, CÓDIGO ****.
Lote 85: LABORATORIO DIDATICO MOVEL. KIT PARA EXTRAÇÃO DE RNA VEGETAL COM COLUNA DE SÍLICA E CAPACIDADE DE RECUPERAÇÃO DE 65 µG RNA A PARTIR DE 100MG DE TECIDO - 50 REAÇÕES. MARCA DE REFERÊNCIA - QIAGEN RNEASY PLANT MINI KIT, CÓDIGO: ****.
Lote 86: LABORATORIO DIDATICO MOVEL. LÂMINA DE BISTURI Nº 11, EM AÇO CARBONO, CAIXA C/100 UNIDADES EMBALADAS INDIVIDUALMENTE EM MATERIAL ALUMINIZADO. MARCA DE REFERÊNCIA: ADVANTIVE.
Lote 87: LABORATORIO DIDATICO MOVEL. LÂMINAS PARA MICROSCOPIA, LÂMINAS DE VIDRO COM ESPESSURA ENTRE 1,0 A 1,2MM; DIMENSÕES: 26 X 76MM; CAIXA COM 50 LÂMINAS SEPARADAS ENTRE SI POR PAPEL MANTEIGA, SELADAS A VÁCUO. MARCA REFERENCIA: KASVI.
Lote 88: LABORATORIO DIDATICO MOVEL. LAMÍNULA, MATERIAL VIDRO, DIMENSÕES CERCA DE 25 X 30. CAIXA COM 50 UNIDADES..
Lote 89: LABORATORIO DIDATICO MOVEL. LAMÍNULAS PARA MICROSCOPIA QUADRADA, 22 X 22MM, ESPESSURA DE 0,13 A 0,16 MM, CAIXA CONTENDO 100 UNIDADES EMBALADAS A VÁCUO EM PAPEL ALUMINIZADO, INDICADO PARA USO EM MICROSCÓPIO. MARCA REFERÊNCIA: PRECISION..
Lote 90: LABORATORIO DIDATICO MOVEL. LAMÍNULAS PARA MICROSCOPIA REDONDAS, PARA PLACA DE 24-POÇOS, 12X0,11MM, CAIXA COM 100 UNIDADES..
Lote 91: LABORATORIO DIDATICO MOVEL. ****, PACOTE COM 10 PLACAS. MARCA DE REFERÊNCIA: LABORCLIN, CÓDIGO ****.
Lote 92: LABORATORIO DIDATICO MOVEL. LUVA CIRÚRGICA, LÁTEX, PARA PROCEDIMENTO, TAMANHO P. CAIXA COM 100 UNIDADES..
Lote 93: LABORATORIO DIDATICO MOVEL. LUVA DE LÁTEX SEM TALCO, TAMANHO M. CAIXA COM 100 UNIDADES.
Lote 94: LABORATORIO DIDATICO MOVEL. LUVA NITRÍLICA S/TALCO, TAMANHO M. CAIXA COM 100 UNIDADES..
Lote 95: LABORATORIO DIDATICO MOVEL. LUVA SEM TALCO NITRÍLICA PP. CAIXA COM 100 UNIDADES..
Lote 96: LABORATORIO DIDATICO MOVEL. LUVA SEM TALCO NITRÍLICA, TAMANHO G. CAIXA COM 100 UNIDADES..
Lote 97: LABORATORIO DIDATICO MOVEL. LUVA NITRÍLICA, SEM TALCO P. CAIXA COM 100 UNIDADES..
Lote 98: LABORATORIO DIDATICO MOVEL. MARCADOR DE PARES DE BASES 50 PB PARA AVALIAÇÃO DOS TRANSCRITOS EM GEL DE AGAROSE, MARCA DE REFERÊNCIA: THERMO FISHER, CÓDIGO ****.
Lote 99: LABORATORIO DIDATICO MOVEL. MATERIAL DE REFERÊNCIA CERTIFICADO (MRC) TAMPÃO DE PH 6,9, COM CERTIFICADO QUE APRESENTE O VALOR DA PROPRIEDADE COM INCERTEZA ASSOCIADA, PRODUZIDO POR PRODUTOR DE MATERIAL DE REFERENCIA (PMR) ACREDITADO SEGUNDO OS REQUISITOS DA ISO GUIA 34. FRASCO DE 250 ML. A VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 1 ANO QUANDO DO RECEBIMENTO.
Lote 100: LABORATORIO DIDATICO MOVEL. MEIO BASE PARA EMJH, MARCA DE REFERÊNCIA: DIFCO, CÓDIGO ****, FRASCO COM 500G.
Lote 101: LABORATORIO DIDATICO MOVEL. Meio base para teste de oxidação e fermentação (OF basal medium), marca referência Difco. 1 frasco de 500 g..
Lote 102: LABORATORIO DIDATICO MOVEL. MEIO DE ENRIQUECIMENTO PARA EMJH, MARCA DE REFERÊNCIA DIFCO, CÓDIGO ****. CAIXA COM 6 FRASCOS DE 100 ML.
Lote 103: LABORATORIO DIDATICO MOVEL. MEMBRANA DE FILTRAÇÃO DE NYLON 66 DE 0,2 MICRA X 47 MM, CAIXA COM 50 UNIDADES.
Lote 104: LABORATORIO DIDATICO MOVEL. MEMBRANA FILTRANTE DE CELULOSE 0,22UM. PACOTE COM 100 UNIDADES..
Lote 105: LABORATORIO DIDATICO MOVEL. MEMBRANA FILTRANTE POLICARBONATO, BRANCA, 0,22UM DE POROSIDADE E 25 MM DE DIÂMETRO. CAIXA COM 100 UNIDADES.
Lote 106: LABORATORIO DIDATICO MOVEL. MICROPIPETAS HOLDING, DIÂMETRO INTERNO ENTRE **** MICRAS E EXTERNO DE **** MICROS, COM ANGULO DE 30 GRAUS. CAIXA COM 10 UNIDADES. MARCA DE REFERÊNCIA HUMAGEN, CÓDIGO MPH-LG-30.
Lote 107: LABORATORIO DIDATICO MOVEL. MICROPIPETAS PARA ICSI, DIÂMETRO INTERNO ENTRE 4-6 MICRAS, COM ANGULO DE 30 GRAUS E BISEL ENTRE 8-11 MICRAS . CAIXA COM 10 UNIDADES. MARCA DE REFERÊNCIA: HUMAGEN REF. ****.
Lote 108: LABORATORIO DIDATICO MOVEL. MICROTUBO 0,5ML, MARCA DE REFERÊNCIA AXYGEN, DNAASE RNAASE FREE. CAIXA COM 500 UNIDADES.
Lote 109: LABORATORIO DIDATICO MOVEL. MICROTUBO 1,5ML, MARCA DE REFERÊNCIA AXYGEN, DNAASE RNAASE FREE. CAIXA COM 500 UNIDADES.
Lote 110: LABORATORIO DIDATICO MOVEL. MICROTUBO 2ML, MARCA DE REFERÊNCIA AXYGEN, DNAASE RNAASE FREE. CAIXA COM 500 UNIDADES.
Lote 111: LABORATORIO DIDATICO MOVEL. MICROTUBO RNAASE E DNAASE FREE, MARCA DE REFERÊNCIA AXYGEN, VOLUME DE 0,5ML.CAIXA COM 500 UNIDADES..
Lote 112: LABORATORIO DIDATICO MOVEL. MICROTUBO TIPO EPPENDORF, MODELO SUPER CLEAR, INCOLOR, VOLUME NOMINAL 0,65 MILILITROS, VOLUME DE TRABALHO 0,5ML, EM RESINA GRAU MÉDICO, COM CORPO GRADUADO E SUPERFÍCIE PARA ANOTAÇÕES, INCLUI TAMPA. CONJUNTO COM **** TUBOS..
Lote 113: LABORATORIO DIDATICO MOVEL. MUFA DUPLA SIMPLES.
Lote 114: LABORATORIO DIDATICO MOVEL. P10 - PONTEIRA 10UL, COM FILTRO, PACOTE COM **** UNIDADES..
Lote 115: LABORATORIO DIDATICO MOVEL. P-10: PONTEIRA 0,1 A 10 UL COM FILTRO (BARREIRA), ESTERILIZADA. ACONDICIONADA EM RACK DE POLIPROPILENO AUTOCLAVÁVEL, COM TAMPA, CONTENDO 96 PONTEIRAS EM CADA. MARCA DE REFERÊNCIA: GILSON, MODELO DFL10ST..
Lote 116: LABORATORIO DIDATICO MOVEL. **** - PONTEIRA ****, SEM FILTRO. RACK COM 96 PONTEIRAS MARCA DE REFERÊNCIA AXYGEN..
Lote 117: LABORATORIO DIDATICO MOVEL. ****: PONTEIRA DE **** COM FILTRO, RNAASE E DNAASE FREE, MARCA REFERENCIA AXYGEN, PACOTE COM **** UNIDADES.
Lote 118: LABORATORIO DIDATICO MOVEL. ****: PONTEIRAS **** UL SEM FILTRO, PCT **** UNIDADES..
Lote 119: LABORATORIO DIDATICO MOVEL. P-20 - PONTEIRA 20UL, COM FILTRO. RACK COM 96 PONTEIRAS MARCA DE REFERÊNCIA AXYGEN..
Lote 120: LABORATORIO DIDATICO MOVEL. P-200 - PONTEIRA 200UL, SEM FILTRO. RACK COM 96 PONTEIRAS MARCA DE REFERÊNCIA AXYGEN..
Lote 121: LABORATORIO DIDATICO MOVEL. P-200: PONTEIRA 20 A 200 UL COM FILTRO (BARREIRA), PRÉ-ESTERILIZADA. ACONDICIONADA EM RACKS DE POLIPROPILENO AUTOCLAVÁVEL, COM TAMPA, CONTENDO 96 PONTEIRAS EM CADA. MARCA DE REFERÊNCIA: GILSON, MODELO DF200ST..
Lote 122: LABORATORIO DIDATICO MOVEL. P-200: PONTEIRA DE 200UL COM FILTRO, RNAASE E DNAASE FREE, MARCA REFERENCIA AXYGEN, PACOTE COM **** UNIDADES.
Lote 123: LABORATORIO DIDATICO MOVEL. P-200: PONTEIRAS 200 UL SEM FILTRO, PACOTE COM **** UNIDADES.
Lote 124: LABORATORIO DIDATICO MOVEL. P-30: PONTEIRA 2 A 30 UL COM FILTRO (BARREIRA), PRÉ-ESTERILIZADA, EM RACKS. ACONDICIONADA EM RACKS DE POLIPROPILENO AUTOCLAVÁVEL, COM TAMPA, CONTENDO 96 PONTEIRAS EM CADA. MARCA DE REFERÊNCIA: GILSON, MODELO DF30ST..
Lote 125: LABORATORIO DIDATICO MOVEL. PAPEL DE FILTRO QUALITATIVO 80G, 11CM DE DIÂMETRO, POROS 14 MICRÔMETROS, PACOTE COM 100 UNIDADES..
Lote 126: LABORATORIO DIDATICO MOVEL. PAPEL DE FILTRO QUALITATIVO 80G, 12,5 CM DE DIÂMETRO, POROS 14 MICRÔMETROS, PACOTE COM 100 UNIDADES.
Lote 127: LABORATORIO DIDATICO MOVEL. PARAFINA HISTOLÓGICA; PARAFINA, ASPECTO FÍSICO HISTOLÓGICA, SÓLIDA, BRANCA, PONTO FUSÃO 56 A 58 GRAUS CELSIUS, APRESENTAÇÃO EM PASTILHA, EMBALAGEM COM 1 KG..
Lote 128: LABORATORIO DIDATICO MOVEL. PARAFORMALDEÍDO, ASPECTO FÍSICO, PÓ BRANCO, ODOR FORTE E PUNGENTE, PESO MOLECULAR 30,03, FÓRMULA QUÍMICA (CH2O)N (P-FORMALDEÍDODO), GRAU DE PUREZA: PUREZA MÁXIMA DE 95, NÚMERO DE REFERÊNCIA QUÍMICA CAS ****, MARCA REFERENCIA: PROQUIMIOS, FRASCO/PACOTE COM 1 KG.
Lote 129: LABORATORIO DIDATICO MOVEL. PBS MODIFICADO 10X ESTÉRIL, FRASCO DE 500 ML.
Lote 130: LABORATORIO DIDATICO MOVEL. PEÇA DE REPOSIÇÃO: MOTOVENTILADOR COMPLETO PARA REPOSIÇÃO EM EQUIPAMENTO MARCA DE REFERÊNCIA VECO, MODELO VLFS, SÉRIE ****, 220 V..
Lote 131: LABORATORIO DIDATICO MOVEL. PEPTONA DE CARNE, BACTERIOLÓGICA, FRASCO COM 500 GRAMAS. MARCA: SIGMA ALDRICH, CÓDIGO: ****.
Lote 132: LABORATORIO DIDATICO MOVEL. PESO-PADRÃO COM VALOR NOMINAL DE 200G CONFECCIONADOS EM AÇO INOXIDÁVEL POLIDO ABNT 310, NA CLASSE DE EXATIDÃO F1. FABRICADOS CONFORME PORTARIA INMETRO NO 233/94 E CONFORME RECOMENDAÇÃO R-111 DA ORGANIZAÇÃO INTERNACIONAL DE METROLOGIA LEGAL (OIML). COM MODELO APROVADO PELO INMETRO, CERTIFICADO DE VERIFICAÇÃO INICIAL DO INMETRO E CERTIFICADO DE CALIBRAÇÃO RBC /INMETRO. OBSERVAR QUE NÃO BASTA SER RASTREÁVEL PELA RBC, É NECESSÁRIO SER CALIBRADO POR LABORATÓRIO ACREDITADO PELO INMETRO E COM SELO DA RBC. ACONDICIONADOS EM ESTOJO DE MADEIRA COM REVESTIMENTO INTERNO DE E.V.A...
Lote 133: LABORATORIO DIDATICO MOVEL. PHENYL ACETATE 99% 100 G MARCA DE REFERÊNCIA: SIGMA ALDRICH CÓDIGO DE REFERÊNCIA: ****.
Lote 134: LABORATORIO DIDATICO MOVEL. PINÇA DE DISSECÇÃO ANATÔMICA, AÇO INOXIDÁVEL, COMPRIMENTO APROXIMADO 14 CM.
Lote 135: LABORATORIO DIDATICO MOVEL. PINÇA DENTE DE RATO EM AÇO INOX, 20 CM. MARCA DE REFERÊNCIA: ABC.
Lote 136: LABORATORIO DIDATICO MOVEL. PINÇA PARA BURETA UNIVERSAL COM CABO - ABERTURA 120 MM.
Lote 137: LABORATORIO DIDATICO MOVEL. PIPETA P10 - MICROPIPETA MONOCANAL DE VOLUME VARIÁVEL DE 1 A 10 UL, PRECISÃO MENOR OU IGUAL A 0,012 UL (0,4%), EXATIDÃO _ 0,025 UL (1,0%), DESIGN ERGONÔMICO, DISPENSAÇÃO REGULADA PELO BOTÃO DE AJUSTE OU PELO DE DISPENSAÇÃO, PISTÃO INTERNO EM AÇO INOXIDÁVEL POLIDO COM VEDAÇÃO A SECO, ISENTO DE LUBRIFICANTE OU GRAXA, AUTOCLAVÁVEL, PIPETAGEM EM NO MÍNIMO TRÊS ESTÁGIOS, BOTÃO DE AJUSTE DE ACIONAMENTO LEVE E COM TRAVA DE SEGURANÇA. MARCAS DE REFERÊNCIA: GILSON, SELECTBIO, HTL.
Lote 138: LABORATORIO DIDATICO MOVEL. PIPETA P10 - MICROPIPETA MONOCANAL, CAPACIDADE 1-10 UL, AJUSTE VOLUME REGULÁVEL, MARCA REFERÊNCIA FINNPIPETTE. MARCA DE REFERÊNCIA: THERMO SCIENTIFIC.
Lote 139: LABORATORIO DIDATICO MOVEL. PIPETA P100 - MICROPIPETA MONOCANAL, CAPACIDADE **** UL, AJUSTE VOLUME REGULÁVEL, MARCA REFERÊNCIA FINNPIPETTE, MARCA DE REFERÊNCIA: THERMO SCIENTIFIC.
Lote 140: LABORATORIO DIDATICO MOVEL. PIPETA **** - MICROPIPETA MONOCANAL DE VOLUME VARIÁVEL DE 100 A **** UL, PRECISÃO MENOR OU IGUAL A 0,012 UL (0,4%), EXATIDÃO _ 0,025 UL (1,0%), DESIGN ERGONÔMICO, DISPENSAÇÃO REGULADA PELO BOTÃO DE AJUSTE OU PELO DE DISPENSAÇÃO, PISTÃO INTERNO EM AÇO INOXIDÁVEL POLIDO COM VEDAÇÃO A SECO, ISENTO DE LUBRIFICANTE OU GRAXA, AUTOCLAVÁVEL, PIPETAGEM EM NO MÍNIMO TRÊS ESTÁGIOS, BOTÃO DE AJUSTE DE ACIONAMENTO LEVE E COM TRAVA DE SEGURANÇA. MARCA DE REFERÊNCIA: GILSON, HTL, SELECTBIO..
Lote 141: LABORATORIO DIDATICO MOVEL. PIPETA **** - MICROPIPETA MONOCANAL, CAPACIDADE **** UL, AJUSTE VOLUME REGULÁVEL, MARCA REFERÊNCIA FINNPIPETTE - THERMO SCIENTIFIC..
Lote 142: LABORATORIO DIDATICO MOVEL. PIPETA P2 - MICROPIPETA MONOCANAL DE VOLUME VARIÁVEL DE 0.1 A 2 UL, PRECISÃO MENOR OU IGUAL A 0,012 UL (0,4%), EXATIDÃO _ 0,025 UL (1,0%), DESIGN ERGONÔMICO, DISPENSAÇÃO REGULADA PELO BOTÃO DE AJUSTE OU PELO DE DISPENSAÇÃO, PISTÃO INTERNO EM AÇO INOXIDÁVEL POLIDO COM VEDAÇÃO A SECO, ISENTO DE LUBRIFICANTE OU GRAXA, AUTOCLAVÁVEL, PIPETAGEM EM NO MÍNIMO TRÊS ESTÁGIOS, BOTÃO DE AJUSTE DE ACIONAMENTO LEVE E COM TRAVA DE SEGURANÇA. MARCAS DE REFERÊNCIA: GILSON, SELECTBIO, HTL.
Lote 143: LABORATORIO DIDATICO MOVEL. PIPETA SOROLÓGICA DESCARTÁVEL 10ML - GRADUAÇÃO 1/10, MARCA DE REFERÊNCIA KASVI.
Lote 144: LABORATORIO DIDATICO MOVEL. PIPETA SOROLÓGICA DESCARTÁVEL 1ML - GRADUAÇÃO 1/10, MARCA DE REFERÊNCIA: KASVI.
Lote 145: LABORATORIO DIDATICO MOVEL. PIPETA SOROLÓGICA DESCARTÁVEL DE 5ML, ESTÉRIL PARA CULTURA DE CÉLULAS, EMBALADAS INDIVIDUALMENTE. PACOTE COM 200 UNIDADES..
Lote 146: LABORATORIO DIDATICO MOVEL. PIPETA VOLUMÉTRICA 5 ML. 1 TRAÇO. MATERIAL VIDRO. ESGOTAMENTO TOTAL. CLASSE A. RASTREÁVEL RBC. ACOMPANHAR CERTIFICADO DE CALIBRAÇÃO PELA RBC. OBSERVAR QUE NÃO BASTA SER RASTREÁVEL PELA RBC, É NECESSÁRIO SER CALIBRADO POR LABORATÓRIO ACREDITADO PELO INMETRO E COM SELO DA RBC.
Lote 147: LABORATORIO DIDATICO MOVEL. PIPETA, TIPO SOROLÓGICA, GRADUAÇÃO GRADUADA, CAPACIDADE 10ML, MATERIAL VIDRO, ESCALA 0,2 EM 0,2 ML, ESTERILIDADE ESTÉRIL, EMBALAGEM INDIVIDUAL, TIPO USO DESCARTÁVEL..
Lote 148: LABORATORIO DIDATICO MOVEL. PISSETA DE 500ML. MARCA DE REFERÊNCIA: J PROLAB.
Lote 149: LABORATORIO DIDATICO MOVEL. PLACA DE CULTIVO CELULAR 24 POÇOS, ESTÉRIL, EMBALADAS INDIVIDUALMENTE. MARCA DE REFERÊNCIA: CORNING OU TPP.
Lote 150: LABORATORIO DIDATICO MOVEL. PLACA DE CULTIVO CELULAR 6 POÇOS (EMBALADAS INDIVIDUALMENTE).
Lote 151: LABORATORIO DIDATICO MOVEL. PLACA DE CULTIVO CELULAR DE 96 POÇOS COM TAMPA.
Lote 152: LABORATORIO DIDATICO MOVEL. PLACA DE ELISA 96 POÇOS FUNDO CHATO DE PVC NÃO TRATADA E NÃO ESTÉRIL, SEM TAMPA. MARCA DE REFERÊNCIA: CORNING - ****.
Lote 153: LABORATORIO DIDATICO MOVEL. PLACA DE PETRI DE POLIESTIRENO ESTÉRIL DE **** MM..
Lote 154: LABORATORIO DIDATICO MOVEL. PLACA DE PETRI DE VIDRO DE 100MM X 15MM. MARCA DE REFERÊNCIA: UNIGLAS.
Lote 155: LABORATORIO DIDATICO MOVEL. PLACA DE PETRI DESCARTÁVEL ESTÉRIL, DIMENSÕES 150 X 15 MM, SEM DIVISÕES, MARCA-REFERÊNCIA JPROLAB.
Lote 156: LABORATORIO DIDATICO MOVEL. PLACA DE PETRI, MATERIAL PLÁSTICO, FORMATO REDONDA, DIMENSÕES CERCA DE 10 X 40, ESTERILIDADE ESTÉRIL. PACOTE COM 20 UNIDADES.
Lote 157: LABORATORIO DIDATICO MOVEL. PLACA DE PETRI, MATERIAL PLÁSTICO, FORMATO REDONDA, DIMENSÕES CERCA DE 15 X 100, ESTERILIDADE ESTÉRIL. PACOTE COM 20 UNIDADES..
Lote 158: LABORATORIO DIDATICO MOVEL. PLACA DE PETRIFILM EC, CONTAGEM COLIFORMES ESCHERICHIA COLI ****, CAIXA COM 50 UNIDADES. MARCA DE REFERÊNCIA: 3M, CÓDIGO ****.
Lote 159: LABORATORIO DIDATICO MOVEL. PLACA DE VIDRO ESCAVADA COM 9 POÇOS, PARA MANIPULAÇÃO DE GAMETAS E EMBRIÕES..
Lote 160: LABORATORIO DIDATICO MOVEL. PLASMA DE COELHO OXALATADO - EDTA. PLASMA DE COELHO (COAGUPLASMA). CAIXA COM 5 FRASCOS DE 3 ML. MARCA DE REFERÊNCIA: LABORCLIN, CÓDIGO ****.
Lote 161: LABORATORIO DIDATICO MOVEL. POLIMIXINA B **** UI (POLIMIXINA B SULFATO), FRASCO COM 1 GRAMA. MARCO DE REFERÊNCIA: PUREX, CÓDIGO: ****.
Lote 162: LABORATORIO DIDATICO MOVEL. POWER SYBR GREEN MASTER MIX (****) - KIT PARA QUANTIFICAÇÃO E DETECÇÃO DE ÁCIDOS NUCLEICOS UTILIZANDO A METODOLOGIA DE PCR EM TEMPO REAL, AMPLIFICAÇÃO BASEADA EM SYBR GREEN. CONTÉM: AMPLITTAQ GOLD DNA POLIMERASE, DNTPS COM DUTP, ROX COMO REFERÊNCIA PASSIVA, TAMPÃO 2X. MARCA DE REFERÊNCIA: THERMO SCIENTIFIC, CÓDIGO ****.
Lote 163: LABORATORIO DIDATICO MOVEL. PRIMER LET-7A (5 -3) 5 - TGAGGTAGTAGGTTGTATAG 3 . PRIMER LET-7A (5 -3) 5 - ESCALA DE 25 NM DESSALINIZADO..
Lote 164: LABORATORIO DIDATICO MOVEL. PRIMER MIRTQ - 5 -3 (DEGENERADO VN) -5 -CGAATTCTAGAGCTCGAGGCAGGCGACATGGCTGGCTAGTTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCTTTTTTTTTTTTTTTTTTTTTTTTTVN -3 . PRIMER MIRTQ (DEGENERADO NA EXTREMIDADE 3´) - ESCALA DE 50 NANOMOLES (NM) DESSALINIZADO..
Lote 165: LABORATORIO DIDATICO MOVEL. PRIMER RTQ-UNIR (5 -3´)- 5 - CGAATTCTAGAGCTCGAGGCAGG 3 PRIMER RTQ-UNIR - ESCALA DE 25 NM DESSALINIZADO..
Lote 166: LABORATORIO DIDATICO MOVEL. PROVETA DE VIDRO BOROSSILICATO DE 50 ML..
Lote 167: LABORATORIO DIDATICO MOVEL. PROVETA GRADUADA DE VIDRO COM BASE HEXAGONAL COM CAPACIDADE DE 100 ML. CLASSE A. RASTREÁVEL RBC. ACOMPANHA CERTIFICADO DE CALIBRAÇÃO PELA RBC NOS PONTOS DE CALIBRAÇÃO 30 ML, 60 ML E 100 ML E CERTIFICADO DIMENSIONAL. OBSERVAR QUE NÃO BASTA SER RASTREÁVEL PELA RBC, É NECESSÁRIO SER CALIBRADO POR LABORATÓRIO ACREDITADO PELO INMETRO E COM SELO DA RBC.
Lote 168: LABORATORIO DIDATICO MOVEL. RACK DUPLA FACE REVERSÍVEL P/ 96 MICROTUBOS DE 0,5 A 2,00ML C/ TAMPA, RESISTENTE A 121¨C.
Lote 169: LABORATORIO DIDATICO MOVEL. RACK TIPO ESTANTE EM PVC PARA ACOMODAR TUBOS TIPO FALCON.
Lote 170: LABORATORIO DIDATICO MOVEL. RACK 4 FACES PARA TUBOS TIPO FALCON E EPPENDORF.
Lote 171: LABORATORIO DIDATICO MOVEL. RACK PARA 100 TUBOS TIPO EPPENDORF 1,5 A 2,0ML. MARCA DE REFERÊNCIA KASVI.
Lote 172: LABORATORIO DIDATICO MOVEL. RACK RETANGULAR 4 FACES PARA TUBOS TIPO FALCON E EPPENDORF.
Lote 173: LABORATORIO DIDATICO MOVEL. RACK PARA 100 CRIOTUBOS OU TUBO TAMANHOS 1,5 A 2,0ML..
Lote 174: LABORATORIO DIDATICO MOVEL. REAGENTE GERADOR DE ANAEROBIOSE, EM SACHET, PARA JARRAS DE 2,5 L. TIPO DE EMBALAGEM: CAIXA DE 10 SACHÊS..
Lote 175: LABORATORIO DIDATICO MOVEL. REGISTRADOR DE TEMPERATURA E UMIDADE DATA LOGGER. MEMÓRIA: **** LEITURAS (**** PARA TEMPERATURA, **** PARA UMIDADE RELATIVA). BATERIA: 3.6V LITHIUM. SAMPLING RATE: SELECIONÁVEL PARA 2S, 5S, 10S, 30S, 1MIN, 10MIN, 30MIN, 1HR, 2HR, 3HR, 6HR, 12HR, 24HR. TEMPERATURA: DE -40 A 70¨C COM PRECISÃO DE _1.0¨C (-20 A 50¨C); _2.0¨C (DEMAIS TEMPERATURAS). UMIDADE RELATIVA DO AR: 0 A 100%, COM PRECISÃO DE _3%UR. TAMANHO: 130 X 30 X 25MM. PESO: 20G. ALARMES PROGRAMÁVEIS PARA LIMITES DE UMIDADE RELATIVA E TEMPERATURA. INDICADOR DE STATUS VIA LED VERMELHO/AMARELO OU VERDE. INTERFACE USB PARA PROGRAMAÇÃO E DOWNLOAD DE DADOS. SOFTWARE DE ANÁLISE USADO PARA VISUALIZAR O GRÁFICO DOS DADOS REGISTRADOS COMPATÍVEL COM SOFTWARE WINDOWS. CAPA PROTETORA DE USB.
Lote 176: LABORATORIO DIDATICO MOVEL. RESINA DE TROCA-IÔNICA DE LEITO MISTO (REFIL) DE 10 POLEGADAS PARA RETENÇÃO DE SAIS DISSOLVIDOS, COMPATÍVEL COM SISTEMA PURIFICADOR DE ÁGUA DE OSMOSE REVERSA..
Lote 177: LABORATORIO DIDATICO MOVEL. RNASE A (20MG/ML), QUALIDADE BIOLOGIA MOLECULAR - 10 ML - MARCA DE REFERÊNCIA INVITROGEN, CÓDIGO ****.
Lote 178: LABORATORIO DIDATICO MOVEL. SACO PARA COLETA DAS AMOSTRAS (BOLSA PARA AMOSTRA SOL/LIQ, C/TARJA, ESTÉRIL 450ML - ****), CAIXA COM 500 UNIDADES. MARCA DE REFERÊNCIA: INLAB, CÓDIGO ****.
Lote 179: LABORATORIO DIDATICO MOVEL. SENSOR PARA AUTOCLAVE PHOENIS - PT 100 LIG. 3 FIOS ROS. M16 INOX 304 RAB. 3X24AWG **** DIAM. 6MM HASTE 40MM..
Lote 180: LABORATORIO DIDATICO MOVEL. SERINGA DE VIDRO COM BICO DE VIDRO - 20 ML..
Lote 181: LABORATORIO DIDATICO MOVEL. SERINGA DESCARTÁVEL 10 ML OPACIDADE TRANSPARENTE. CAIXA COM 100 UNIDADES.
Lote 182: LABORATORIO DIDATICO MOVEL. SERINGA DESCARTÁVEL 20 ML OPACIDADE TRANSPARENTE. CAIXA COM 100 UNIDADES.
Lote 183: LABORATORIO DIDATICO MOVEL. SERINGA DESCARTÁVEL 5ML OPACIDADE TRANSPARENTE SEM AGULHA. CAIXA COM 100 UNIDADES.
Lote 184: LABORATORIO DIDATICO MOVEL. SERINGA DESCARTÁVEL, SEM AGULHA, 3 ML, CAIXA COM 100 UNIDADES.
Lote 185: LABORATORIO DIDATICO MOVEL. SERINGA INSULINA COM AGULHA, CAIXA COM 100 UNIDADES. MARCA REFERENCIA DESCARPACK.
Lote 186: LABORATORIO DIDATICO MOVEL. SÍLICA GEL AZUL 4MM X 8MM. MARCA DE REFERÊNCIA: SYNTH.
Lote 187: LABORATORIO DIDATICO MOVEL. SOLUÇÃO PH 4,0. NA EMBALAGEM DEVERÁ CONSTAR DATA DE FABRICAÇÃO RECENTE, PRAZO DE VALIDADE, NÚMERO DE LOTE. ACOMPANHA CERTIFICADO DE ANÁLISE DO PRODUTO. FRASCO COM 500 ML. MARCA DE REFERÊNCIA: SYNTH.
Lote 188: LABORATORIO DIDATICO MOVEL. SOLUÇÃO PH 7,0. NA EMBALAGEM DEVERÁ CONSTAR DATA DE FABRICAÇÃO RECENTE, PRAZO DE VALIDADE, NÚMERO DE LOTE. ACOMPANHA CERTIFICADO DE ANÁLISE DO PRODUTO. FRASCO COM 500 ML. MARCA DE REFERÊNCIA: SYNTH.
Lote 189: LABORATORIO DIDATICO MOVEL. SUPLEMENTO DIFERENCIAL PARA MEIO DE CULTIVO FRASER BROTH. SUPLEMENTO DIFERENCIAL PARA SUPLEMENTAR MEIO DE CULTIVO TIPO FRASER PARA ISOLAMENTO SELETIVO E O CULTIVO DE LISTERIA MONOCYTOGENES ENCONTRADAS EM ALIMENTOS HUMANO E ANIMAL. COMPOSIÇÃO - CITRATO FÉRRICO DE AMÔNIO: 250,00 MG POR FRASCO. CAIXA COM 10 FRASCOS..
Lote 190: LABORATORIO DIDATICO MOVEL. SWAB ESTÉRIL PARA COLETA DE AMOSTRAS, COM HASTE FLEXÍVEL, COMPRIMENTO DE 15 CM OU MAIS. PACOTE COM 100 UNIDADES.
Lote 191: LABORATORIO DIDATICO MOVEL. SYBR GREEN PCR MASTER MIX MARCA DE REFERÊNCIA: APPLIED BIOSYSTEMS, CÓDIGO: ****.
Lote 192: LABORATORIO DIDATICO MOVEL. TAMPÃO BD FACSFLOW (BD BIOSCIENCES, CÓDIGO Nº ****) UTILIZADO COMO FLUIDO DE MANUTENÇÃO DO CITÔMETRO DE FLUXO..
Lote 193: LABORATORIO DIDATICO MOVEL. TAMPÃO FACSRINSE (BD BIOSCIENCES, CÓDIGO Nº ****, FRASCO COM 5 LITROS) PARA USO EM CITÔMETRO DE FLUXO COMO SOLUÇÃO DE MANUTENÇÃO..
Lote 194: LABORATORIO DIDATICO MOVEL. TAQ DNA POLIMERASE (ENZIMA) COM TAMPÃO VERDE 5X CONCENTRADO E INCOLOR 5X CONCENTRADO, E TUBO SEPARADO DE MGCL2 A 25 MM. KIT COM ****. MARCA REFERÊNCIA: PROMEGA CAT.:****.
Lote 195: LABORATORIO DIDATICO MOVEL. TAQ DNA POLYMERASE 500 UNITS, 5 U/ L. TAQ TIPO SELVAGEM COM 10X KAPA TAQ BUFFER A, 10X KAPA TAQ BUFFER B (AMBOS COM MG2+ A 1X CONC. DE 1.5 MM), E MGCL2 EXTRA (25 MM) 500U. **** KAPA. MARCA DE REFERÊNCIA: KAPA, CÓDIGO ****.
Lote 196: LABORATORIO DIDATICO MOVEL. TOLUENO, ASPECTO FÍSICO LÍQUIDO INCOLOR, ODOR CARACTERÍSTICO DE BENZENO, COMPOSIÇÃO QUÍMICA C7H8, PESO MOLECULAR 92,14, TEOR DE PUREZA PUREZA MÍNIMA DE 99,9%, CARACTERÍSTICA ADICIONAL REAGENTE PARA HPLC, NÚMERO DE REFERÊNCIA QUÍMICA CAS ****.
Lote 197: LABORATORIO DIDATICO MOVEL. TRADO DE INCREMENTO: TRADO DE INCREMENTO DENDROMÉTRICO, SONDA PRESSLER, 300MM X 3ROSCAS; REFERÊNCIA: http://www.***.*.*/produto/****/trado-de-incremento.aspx.
Lote 198: LABORATORIO DIDATICO MOVEL. TUBO CÔNICO PARA PCR (INCLUI TAMPA CHATA), MARCA DE REFERÊNCIA: LABCON, MODELO PCR02-N, INCOLOR, VOLUME DE 0,2 MILILITROS, PACOTE COM **** UNIDADES..
Lote 199: LABORATORIO DIDATICO MOVEL. TUBO CRIOGÊNICO, ****, COM TAMPA DE ROSCA, VOLUME DE 5ML, MATERIAL PLÁSTICO E ESTÉRIL. PACOTE COM **** UNIDADES.
Lote 200: Laboratório - Análise Biológica . SERVIÇO DE SEQUENCIAMENTO DE DNA (SEGMENTO DE DNA CLONADOS OU NA FORMA DE FRAGMENTO DE PCR) UTILIZANDO O MÉTODO DE SEQUENCIAMENTO DE SANGER. A SEQUENCIA GERADA DEVE TER PELO MENOS 600 BASES COM QUALIDADE PHRED SUPERIOR À 20..
Lote 201: LABORATORIO DIDATICO MOVEL. TUBO FALCON 50 ML: TUBO LABORATÓRIO, TIPO CENTRÍFUGA, MATERIAL POLIPROPILENO, TIPO FUNDO CÔNICO, CAPACIDADE 50, ACESSÓRIOS TAMPA ROSQUEÁVEL, GRADUAÇÃO GRADUADO, ESTERILI-DADE ESTÉRIL, APIROGÊNICO, LIVRE DE DNASE E RNASE, USO DESCARTÁVEL. REFERÊNCIA: http://e-labcommerce.com/plasticos/tubos/tipo-falcon/tubos-falcon-50ml.html.
Lote 202: LABORATORIO DIDATICO MOVEL. TUBO PARA COLETA DE SANGUE COM VÁCUO E CITRATO DE SÓDIO COM VOLUME DE 9 ML.
Lote 203: LABORATORIO DIDATICO MOVEL. TUBO DE CITOMETRIA NO TAMANHO DE 5 ML COM DIMENSÔES DE 75MM X 12MM, MARCA DE REFERÊNCIA FALCON BD, CÓDIGO ****, CAIXA COM 500 UNIDADES..
Lote 204: LABORATORIO DIDATICO MOVEL. TUBOS DE ENSAIO COM TAMPA DE ROSCA DE 9 ML, 13 X 100MM. TUBO DE ENSAIO, PAREDE REFORÇADA, TAMPA ROSQUEÁVEL. MARCA DE REFERÊNCIA: PYREX, CÓDIGO ****.
Lote 205: LABORATORIO DIDATICO MOVEL. TUBOS DE PCR EM TEMPO REAL MICROAMP® FAST 8-TUBE STRIP (0.1-ML). MARCA DE REFERÊNCIA: THERMO SCIENTIFIC, CÓDIGO: ****. COM 125 TIRAS.
Lote 206: LABORATORIO DIDATICO MOVEL. XILOL PA, PARA PREPARAÇÕES HISTOLÓGICAS, FRASCO DE **** ML. MARCA REFERENCIA: QEEL - QUÍMICA ESPECIALIZADA LTDA..
Lote 207: LABORATORIO DIDATICO MOVEL. COLUNA PARA HPLC COMPATÍVEL COM CATÁLOGO AMINEX HPX-87H 300 X 7.8. MARCA DE REFERÊNCIA BIORAD, CÓDIGO ****.
Lote 208: LABORATORIO DIDATICO MOVEL. HEXANO PADRÃO LC/MS, PUREZA PARA ESTE TIPO DE ANÁLISE..

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.