Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Pregão Eletrônico Edital: 7/2016- Brasília Df |

Atualizado em 16/09/2016. Acesse também licitações mais recentes e baixe os editais.

16/09/2016 - DF ( BRASÍLIA ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/EMBRAPA/CNPH (UASG: 135040)

Aquisição de Reagentes Químicos.

Lote 1: LABORATORIO DIDATICO MOVEL. 2,2-Azino-Bis-(ácido 3-etilbenzotiazolina-6-sulfônico), sal diamônio, pureza mínima 98%, frasco com 1,0 grama..
Lote 2: LABORATORIO DIDATICO MOVEL. ****. Inibidor potente e seletivo da MPs1 (IC50 = 35 nM). Frasco com 10MG. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 3: LABORATORIO DIDATICO MOVEL. Acetanilida 99.0% de pureza. Frasco de 100G. Referência: ****. MARCA: MERCK. Conforme Justificativa Técnica..
Lote 4: LABORATORIO DIDATICO MOVEL. Acetato de 1- naftilo ( 1- naphtyl acetate); peso molecular: 186,21 g/mol; CAS ****; **** O2; pureza maior ou igual a 98%; temperatura de estocagem: -20¨C. Frasco de 100g..
Lote 5: LABORATORIO DIDATICO MOVEL. Acetato de Potássio para biologia molecular. Frasco com 01 KG..
Lote 6: LABORATORIO DIDATICO MOVEL. Acetona 99,5%. P.A. Frasco de **** mL. OBS: Produto Controlado pela Policia Federal..
Lote 7: LABORATORIO DIDATICO MOVEL. Acetona PA. Frasco de ****. OBS: Produto Controlado pela Polícia Federal..
Lote 8: LABORATORIO DIDATICO MOVEL. Acetona para HPLC, Nº CAS: ****, frasco com ****.
Lote 9: LABORATORIO DIDATICO MOVEL. Acetonitrila pureza HPLC JT Backer, galão 4 litros. OBS: Produto Controlado pela Polícia Federal..
Lote 10: LABORATORIO DIDATICO MOVEL. Acido 3,5 dinitrossalicilico(dns). Frasco com ****.
Lote 11: LABORATORIO DIDATICO MOVEL. Acido Cloridrico 37% PA ACS ISO. Frasco de 01 Litro. OBS: Produto Controlado pela Polícia Federal..
Lote 12: LABORATORIO DIDATICO MOVEL. Acido Fluorídrico 48% P.A. ACS ISO. Frasco de 1 Litro. OBS: Produto Controlado pelo Ministério do Exército..
Lote 13: LABORATORIO DIDATICO MOVEL. Acido L-Ascórbico PA-ACS ISO. Frasco de 250gr..
Lote 14: 99%. Frasco de 5G. Grau HPLC..
Lote 15: 99%. Frasco de 5G. Grau HPLC..
Lote 16: LABORATORIO DIDATICO MOVEL. Acido Peracético concentração de 5%. Frasco de 5 litros..
Lote 17: LABORATORIO DIDATICO MOVEL. Acido Sulfuroso 6% PA. Frasco de 1 Litro..
Lote 18: LABORATORIO DIDATICO MOVEL. Acido Sulfúrico, ACS reagente, ****, densidade de vapor
Lote 19: =99.0%, frasco com 250 gramas. Referência: ****. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 20: LABORATORIO DIDATICO MOVEL. Acido ascorbico PA ACS, frasco com 500 gramas. MARCA: SIGMA-ALDRICH. Conforme Justificativa Técnica. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 21: LABORATORIO DIDATICO MOVEL. Acido borico PA-ACS - 500g. - P.M. **** Pureza 99,8% - H3BO3 - Reagente Ultrapuro para preparaçao de tampoes. MARCA: SIGMA-ALDRICH. Conforme Justificativa Técnica..
Lote 22: LABORATORIO DIDATICO MOVEL. Acido clorídrico PA (HCL). Frasco com ****.
Lote 23: 99%. Frasco de 500MG. Grau HPLC..
Lote 24: LABORATORIO DIDATICO MOVEL. Acido metafosfórico PA. Frasco com 500 ml..
Lote 25: LABORATORIO DIDATICO MOVEL. Acido nitrico 65% P.A padrao ACS ISSO. Frasco com 01 Litro. OBS: Produto Controlado pelo Ministério do Exército..
Lote 26: LABORATORIO DIDATICO MOVEL. Acido nítrico PA, frasco com ****. OBS: Produto Controlado pelo Ministério do Exército..
Lote 27: LABORATORIO DIDATICO MOVEL. Acido sorbico, aspecto fisico po branco, cristalino, formula quimica C6H8O2, peso molecular 112,13; grau de pureza minima de 99%, caracteristica adicional reagente. Frasco de 250 gramas..
Lote 28: LABORATORIO DIDATICO MOVEL. Acido sulfurico PA (h2so4). Frasco com ****. OBS: Produto Controlado pela Polícia Federal..
Lote 29: LABORATORIO DIDATICO MOVEL. Agar agar em pó. Frasco com 500GR..
Lote 30: 30 kb;Gel Compatibility: Agarose Gels; Validated Application: Gel Electrophoresis; Green Features: Sustainable packaging; Shipping Condition: Room Temperature; Regulatory Statement: For Research Use Only. MARCA: INVITROGEN. Conforme Justificativa Técnica..
Lote 31: LABORATORIO DIDATICO MOVEL. Alcool etilico 95%,frasco com ****.
Lote 32: LABORATORIO DIDATICO MOVEL. Alcool etilico Absoluto, P.A. frasco com ****.
Lote 33: LABORATORIO DIDATICO MOVEL. Alcool etilico hidratado 70,0º INPM (77¨ gl), atendendo a NBR ****/97, validade mínima de 12 meses, frasco com ****.
Lote 34: LABORATORIO DIDATICO MOVEL. Alcool etilico hidratado 96¨ gl (96% de pureza), 92,8º INPM, atendendo a NBR ****/97, validade de 12 meses, frasco com ****.
Lote 35: LABORATORIO DIDATICO MOVEL. Alcool etilico hidratado, liquido 70%, para uso hospitalar, ****.
Lote 36: LABORATORIO DIDATICO MOVEL. Alcool etílico absoluto P.A.-A.C.S. (790g) 99,5%. Frasco com 01 litro. MARCA: JT BAKER. Conforme Justificativa Técnica..
Lote 37: LABORATORIO DIDATICO MOVEL. Alcool isoamilico, sinonimos: 3-Methyl-1-butanol, Isoamyl alcohol, Isopentyl alcohol, Fórmula Linear: (CH3)2CHCH2CH2OH, Peso Molecular: ****. Frasco com ****.
Lote 38: LABORATORIO DIDATICO MOVEL. Alcool metilico 99,8% PA ACS. Frasco com ****.
Lote 39: LABORATORIO DIDATICO MOVEL. Alfa-acetato de tocoferil ou a-tocopheryl acetate. Padrão para análises de HPLC, frasco de 500 MG. Grau HPLC..
Lote 40: LABORATORIO DIDATICO MOVEL. Ampicilina dissódica, ****,5% para cultura de células, ****. Frasco com 100 gramas..
Lote 41: LABORATORIO DIDATICO MOVEL. Anticorpo de cadeia alfa tubulina (Tubulin alpha chain antibody) Peptidio KLH conjugada com derivados de sequências de cadeia tubulina alfa disponíveis, incluindo Arabidopsis thaliana tubulina-1-cadeia alfa **** (****), alfa-2 / alfa-4 de cadeia B9DGT7 (****), alfa-5 de cadeia B9DHQ0 (****), alfa-6 cadeia **** (****). Frasco com 100 microlitros (uL). Referência: Agrisera Atibodies/Uniscience. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 42: LABORATORIO DIDATICO MOVEL. Antissoro policlonal para Lettuce mosaic vírus (LMV), Bioreba **** e conjugado Bioreta ****. Apresentação: **** testes..
Lote 43: LABORATORIO DIDATICO MOVEL. BCA - Kit Ácido Bicinconinico para determinação de proteínas para **** ng / mL de proteína. Referência: BCA1/Sigma. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 44: LABORATORIO DIDATICO MOVEL. Biocida para sanitização de ultrapurificador de água. Biocida com princípio ativo glutaraldeído mínimo 9,5%, aspecto líquido incolor transparente, pH 3,0-5,0, totalmente solúvel em água, estabilidade em temperatura até 80oC. Frasco com 250mL..
Lote 45: LABORATORIO DIDATICO MOVEL. Borohidreto de Sódio PA ACS ISO, granulado fino. Formula NaBH4, massa molar 37,83 g/mol. Frasco de 100G. MARCA: SIGMA-ALDRICH. Conforme Justificativa Técnica. OBS: Produto Controlado pela Polícia Federal..
Lote 46: LABORATORIO DIDATICO MOVEL. C-PTIO. Sal de Potássio Carboxi-PTIO. Frasco de 10MG. Referência: C221/Sigma. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 47: LABORATORIO DIDATICO MOVEL. Carbonato de sódio anidro PA, frasco de 100 gramas. OBS: Produto Controlado pela Polícia Federal..
Lote 48: LABORATORIO DIDATICO MOVEL. Cloreto Trifenil Tetrazolio. Frasco de 10GR..
Lote 49: LABORATORIO DIDATICO MOVEL. Cloreto de Cálcio (2H2O) PA, frasco com 500 gramas. MARCA: SIGMA-ALDRICH. Conforme Justificativa Técnica..
Lote 50: LABORATORIO DIDATICO MOVEL. Cloreto de manganês PA ACS. Frasco com 500 gramas..
Lote 51: LABORATORIO DIDATICO MOVEL. Cloreto de sodio PA, ultra puro, frasco de 01KG..
Lote 52: LABORATORIO DIDATICO MOVEL. Cloridrato L-Name N-Nitro-L-arginina metil ester cloridrato (TLC), powder. Frasco 1G. Referência: ****. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 53: LABORATORIO DIDATICO MOVEL. Clorofórmio PA, frasco com ****. MARCA: JT BAKER. Conforme Justificativa Técnica. OBS: Produto Controlado pela Polícia Federal..
Lote 54: LABORATORIO DIDATICO MOVEL. Cocktail de Inibidor de Protease (EDTA-livre, 100X em DMSO). Frasco de 1 mL × 10. Referência: **** (MedChem Express). OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 55: LABORATORIO DIDATICO MOVEL. Concanamicina A (Inibidor da V-ATPase). Frasco de 25 microgramas. Referência: ****/Sigma. MARCA: SIGMA-ALDRICH. Conforme Justificativa Técnica..
Lote 56: LABORATORIO DIDATICO MOVEL. Cucurbitacin B hydrate: frasco de 5MG. Padrão químico para análise em HPLC. Grau HPLC..
Lote 57: LABORATORIO DIDATICO MOVEL. Cucurbitacin E: frasco de 5 mg. Padrão químico para análises em HPLC. Grau HPLC..
Lote 58: =99% (HPLC). Frasco de 10G. Referência: ****/Sigma. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 59: LABORATORIO DIDATICO MOVEL. DAPI - para a coloração de ácido nucleico. Sinônimo: 2- (4-aminofenil) -6-indocarb amidina dicloridrato, 4, dicloridrato de 6-diamidino-2-fenilindole, dicloridrato DAPI. Frasco com 10MG. Referência: **** SIGMA / ****-10MG. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 60: LABORATORIO DIDATICO MOVEL. Dextrose (d.glicose anidra), frasco com 500 gramas..
Lote 61: LABORATORIO DIDATICO MOVEL. Diclorofenol 2,6 indofenol (DCPIP), frasco com 5 gramas..
Lote 62: LABORATORIO DIDATICO MOVEL. Dimetil-N-N P Fenilenodiamina Monocloridrato. Frasco de 25G..
Lote 63: LABORATORIO DIDATICO MOVEL. Dimetilsulfóxido (DMSO), reagente químico,grau PA. Frasco de 01 Litro..
Lote 64: LABORATORIO DIDATICO MOVEL. Dl-dithiothreitol (DTT), frasco com 5 gramas. MARCA: SIGMA-ALDRICH. Conforme Justificativa Técnica. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 65: LABORATORIO DIDATICO MOVEL. Dna ligase obtida de E. Col. T4 infecta frasco com 100 unidades..
Lote 66: 99% de pureza e testado para PCR (30kb PCR e RT-PCR). MARCA: INVITROGEN. Conforme Justificativa Técnica..
Lote 67: LABORATORIO DIDATICO MOVEL. Enzima RNAseOUT inibidor de ribonuclease recombinante (500U). Enzima de origem vegetal, utilizada em reação da transcrição reversa. MARCA: PROMEGA. Conforme Justificativa Técnica..
Lote 68: LABORATORIO DIDATICO MOVEL. Eter de petróleo PA. Frasco com ****. OBS: Produto Controlado pela Polícia Federal..
Lote 69: LABORATORIO DIDATICO MOVEL. Extrato de levedura. Frasco com 500gr PA..
Lote 70: LABORATORIO DIDATICO MOVEL. Formol (formaldeído), aspecto físico líquido aquoso, incolor, límpido, concentração teor entre 37 e 40%, característica adicional reagente P.A. Frasco com ****.
Lote 71: LABORATORIO DIDATICO MOVEL. Fosfatase Inhibitor Cocktail I (100X em DMSO). Frasco de 1 mL × 10. Referência: ****. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 72: LABORATORIO DIDATICO MOVEL. GelRed. É um corante fluorescente de ácidos nucleicos ultra-sensível. Frasco de 05ML. MARCA: BIOTIUM. Conforme Justificativa Técnica..
Lote 73: LABORATORIO DIDATICO MOVEL. Gramicidina. Frasco de 1G. Referência: ****. MARCA: SIGMA-ALDRICH. Conforme Justificativa Técnica..
Lote 74: LABORATORIO DIDATICO MOVEL. Hidróxido de potássio (KOH), PA, 85%. Frasco de 01Kg. OBS: Produto Controlado pela Polícia Federal..
Lote 75: LABORATORIO DIDATICO MOVEL. High-Capacity CDNA Reverse Transcription Kit With RNASE Inhibitor. Kit com **** Reações. Utilizado para reação de conversão de RNA em CNDA. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 76: =94.0% (HPLC). Sinônimo: 3,8-diamino-5- [3- (trimetilamónio) propil] -6-fenil fenantridina diiodeto. Frasco com 25MG. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 77: LABORATORIO DIDATICO MOVEL. Ionóforo de Hidrogênio I - cocktail B Selectophore. Frasco de 01ML. Referência: ****.
Lote 78: LABORATORIO DIDATICO MOVEL. Isopropanol, frasco com 01 litro. MARCA: JT BAKER. Conforme Justificativa Técnica..
Lote 79: LABORATORIO DIDATICO MOVEL. Kit para análise de frutanas (Frutan HK assay kit 50). Kit para 50 ensaios, contendo: 1 frasco com tampão (25 ml, pH 7,6), mais azida de sódio (0,02% m/v) como conservante, estável mais que 2 anos a 4 ¨C; 1 frasco com NADP mais ATP estáveis por 5 anos a -20 ¨C; 1 frasco com Sacarose/maltase, pó liofilizado, mais BSA, estáveis por 5 anos a -20 ¨C; 1 frasco com Fructanase (recombinante, purificado por afinidade de exo-e endo-inulinase), pó liofilizado e estável por 5 anos a -20 ¨C; 1 frasco com Desidrogenase hexoquinase e glicose-6-fosfato e IGP suspensão, 2,25ml, estável por 4 anos a 4 ¨C; 1 frasco com Solução padrão de D-frutose (0,5 mg/ml) em 0,2% (m/v) de ácido benzóico e estável por 4 anos na temperatura ambiente; 1 frasco com amostra de controle de frutanas (em forma de farinha), Dália frutanas criodessecada na presença de celulose, estáveis por 5 anos armazenado em local seco à temperatura ambiente. Produto de referência: Megazyme..
Lote 80: LABORATORIO DIDATICO MOVEL. Kit para extração de DNA de solo para 100 reações. O kit dever possuir tecnologia para remover inibidores e isolar DNA genômico de fungos e bactérias de todos os tipos de solo e ambiente. O DNA genômico deve possuir alto nível de pureza para amplificação por PCR e qPCR e sequenciamento pelos métodos de Sanger e de última geração (NGS)..
Lote 81: LABORATORIO DIDATICO MOVEL. LCGC Certificados de vidro transparente (Certified Clear Glass) 12 x 32mm. Frasco de gargalo de rosca de recuperação total, com tampa e septo de PTFE/silicone , Frasco 1 mL de volume, 100/pkg ****. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 82: LABORATORIO DIDATICO MOVEL. Lader 1 kb DNA plus 250UG..
Lote 83: LABORATORIO DIDATICO MOVEL. M-MLV reverse transcriptase, ****.
Lote 84: LABORATORIO DIDATICO MOVEL. ****. Inibidor ATP-competitivo da MPs1 com IC50 de 1.8mM. Frasco com 2MG. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 85: LABORATORIO DIDATICO MOVEL. Meio de batata-dextrose ágar (potato-dextrose-agar) em pó - frasco de 500 gramas..
Lote 86: LABORATORIO DIDATICO MOVEL. Metanol grau HPLC. Frasco com ****.
Lote 87: LABORATORIO DIDATICO MOVEL. Mineral oil (Óleo Mineral Branco) - light white oil ****, frasco de 1 litro..
Lote 88: LABORATORIO DIDATICO MOVEL. Mps1-IN-2: ****-(4-hidroxi-1-piperidinil)fenilamina]-5,7,8,9-tetrahidro-5-methyl-6H-pirimido[4,5-b][1,4]diazepina-6-one. Frasco com 5MG. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 89: LABORATORIO DIDATICO MOVEL. Mps1-IN-3: 1-(4-(6-(2-(Isopropil sulfonil) fenilamina)-9H-purin-2-ilamino)-3-metoxifenil)piperidina-4-ol. Frasco com 5MG. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 90: LABORATORIO DIDATICO MOVEL. Murashige e Skoog Meio Basal em pó, cultura de células vegetais testados. Frasco rende 50L. Sinônimo: MS Meio Basal. Referência: ****. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 91: LABORATORIO DIDATICO MOVEL. NMS-P715. Inibidor ATP-competitivo e biodisponível oralmente da MPS1 (IC50 = 8 Nm). Frasco com 2MG. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 92: =98%. Frasco com 500GR. Referência: ****/Sigma. MARCA: SIGMA-ALDRICH. Conforme Justificativa Técnica. OBS: Produto Controlado pelo Ministério do Exército..
Lote 93: LABORATORIO DIDATICO MOVEL. Nitrato de calcio PA 99%, frasco 500 gramas. MARCA: SIGMA-ALDRICH. Conforme Justificativa Técnica..
Lote 94: LABORATORIO DIDATICO MOVEL. Nitrato de potássio PA. Frasco com 500 gramas. MARCA: SIGMA-ALDRICH. Conforme Justificativa Técnica. OBS: Produto Controlado pelo Ministério do Exército..
Lote 95: LABORATORIO DIDATICO MOVEL. Nitrato de potássio, peso molecular 101,10, PA. Frasco de **** gramas. OBS: Produto Controlado pelo Ministério do Exército..
Lote 96: LABORATORIO DIDATICO MOVEL. Nitroprussiato de sódio di-hidratado (Sodium nitroprusside dihydrate). Frasco 100G. Referência ****. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 97: =98.0%, pó. Sinônimo: 1,2-diaminobenzeno, 1,2-fenilenodiamina, OPD. Frasco de 50G. Referência: ****/Sigma. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 98: LABORATORIO DIDATICO MOVEL. Oleo Mineral Naturol. Frasco com 100ML..
Lote 99: =90% com base oligomicina total (HPLC). Frasco de 5MG. Referência: ****. MARCA: SIGMA-ALDRICH. Conforme Justificativa Técnica..
Lote 100: LABORATORIO DIDATICO MOVEL. Oligonucleotídeo ITS4 - Sequencia 5`TCCTCCGCTTATTGATATCG 3`, 20 bases, escala 200nmol..
Lote 101: LABORATORIO DIDATICO MOVEL. Oligonucleotídeo ITS5 - Sequencia 5`GGAAGTAAAAGTCGTAACAAGG 3`, 22 bases, escala 200nmol..
Lote 102: LABORATORIO DIDATICO MOVEL. PGEM T Easy Vector System I. Frasco de 20 reações. MARCA: PROMEGA. Conforme Justificativa Técnica..
Lote 103: LABORATORIO DIDATICO MOVEL. Padrão **** para uso com Analisador Elementar. Frasco com 50GR. MARCA: PERKIN ELMER. Conforme Justificativa Técnica..
Lote 104: LABORATORIO DIDATICO MOVEL. Padrão Oxido de Cobre de alta pureza para uso com Analisador Elementar. Frasco com 454G. ****. MARCA: PERKIN ELMER. Conforme Justificativa Técnica..
Lote 105: LABORATORIO DIDATICO MOVEL. Padrão Tungstato de Prata/Óxido de Magnésio de alta pureza para uso com Analisador Elementar. Frasco com 100G. ****. MARCA: PERKIN ELMER. Conforme Justificativa Técnica..
Lote 106: LABORATORIO DIDATICO MOVEL. Padrão Vanadato de Prata de alta pureza para uso com Analisador Elementar. Frasco com 40G. ****. MARCA: PERKIN ELMER. Conforme Justificativa Técnica..
Lote 107: LABORATORIO DIDATICO MOVEL. Padrão de Alfa tocoferol com 95% de pureza, padrão HPLC. Frasco com 100 miligramas..
Lote 108: LABORATORIO DIDATICO MOVEL. Padrão de Delta Tocoferol, padrão HPLC, peso molecular **** ( analytical standard) Sulpeco. Frasco de 100 miligramas. Grau HPLC..
Lote 109: LABORATORIO DIDATICO MOVEL. Padrão de Gama Tocoferol, padrão HPLC ((R,R,R)-y-Tocopherol, 7,8-Dimethyltocol ). Peso molecular ****. Frasco de 25 miligramas..
Lote 110: LABORATORIO DIDATICO MOVEL. Peroxido de hidrogênio 35% (**** g) PA, frasco com 01 litro. OBS: Produto Controlado pela Polícia Federal..
Lote 111: LABORATORIO DIDATICO MOVEL. Primer para detecção viral, dessalinizado, 50 nMol, com 20 bases, segundo sequência: ToMoLCV-R - (5-TGGACCACARAGTAAAAGAC -3). MARCA: INVITROGEN. Conforme Justificativa Técnica..
Lote 112: LABORATORIO DIDATICO MOVEL. Primer para detecção viral, dessalinizado, 50 nMol, com 21 bases, segundo sequência: **** For - (5- AGTTGGCTTGTGTGGCTTATC -3). MARCA: INVITROGEN. Conforme Justificativa Técnica..
Lote 113: LABORATORIO DIDATICO MOVEL. Primer para detecção viral, dessalinizado, 50 nMol, com 21 bases, segundo sequência: ToMoLCV-F- (5-CATCTTCRTGKAATTCTCTGG -3). MARCA: INVITROGEN. Conforme Justificativa Técnica..
Lote 114: LABORATORIO DIDATICO MOVEL. Primer para detecção viral, dessalinizado, 50 nMol, com 23 bases, segundo sequência: MYaV - **** Rev - (5- AATCTGGCAAGTACAATGTGGTG -3). MARCA: INVITROGEN. Conforme Justificativa Técnica..
Lote 115: LABORATORIO DIDATICO MOVEL. Primer para detecção viral, dessalinizado, 50 nMol, com 24 bases, segundo sequência: **** Rev - (5- CGATTCAGAGATAGCATCATTGGC -3). MARCA: INVITROGEN. Conforme Justificativa Técnica..
Lote 116: LABORATORIO DIDATICO MOVEL. Primer para detecção viral, dessalinizado, 50 nMol, com 24 bases, segundo sequência: **** For - (5- GAATGACACAGCCACATTTCTCAT -3). MARCA: INVITROGEN. Conforme Justificativa Técnica..
Lote 117: LABORATORIO DIDATICO MOVEL. PureLink Quick PCR Purification kit 250 reações invitrogen ****.
Lote 118: LABORATORIO DIDATICO MOVEL. Reagente de alta pureza para Analisador Elementar CHN modelo ****, Gaze de Prata, 0,5x6. ****. MARCA: PERKIN ELMER. Conforme Justificativa Técnica..
Lote 119: LABORATORIO DIDATICO MOVEL. Reversine. análogo sintético de purina (2,6-disubstituted purine). Inibidor de Aurora A/B/C com IC50s de **** nM. Frasco com 5MG. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 120: LABORATORIO DIDATICO MOVEL. SDS (Dodecil sulfato de sódio) PA, frasco com 500gr..
Lote 121: =97%, pó (N-Acetil-3- (nitrosotiol) -DL-valina, S-nitroso-N-acetylpenicillamine). Frasco de 25MG. Referência: ****/Sigma. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ)Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 122: LABORATORIO DIDATICO MOVEL. ****. Inibidor de amplo espectro para JNK, MKK4, MKK3, MKK6, PKB, PKC1, ERK2, p38, Chk1, EGFR. Frasco com 50MG. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 123: LABORATORIO DIDATICO MOVEL. Sacarose PA, frasco com 500 gramas..
Lote 124: LABORATORIO DIDATICO MOVEL. Soda Lime. Granulometria de 6-12 mesh, em embalagem de 450G, para uso somente para o analisador de fotossíntese **** (IRGA). Referência/Catálogo: ****.
Lote 125: LABORATORIO DIDATICO MOVEL. Solução 40% Acrilamida / bisacrilamida 19:1, frasco de ****.
Lote 126: LABORATORIO DIDATICO MOVEL. Solução de Formaldeído reagente ACS, 37 wt. % Em H2O, contém **** de metanol como estabilizante (para evitar a polimerização). Frasco de 1L. Referência: ****/Sigma..
Lote 127: LABORATORIO DIDATICO MOVEL. Solução de Glutaraldeído. Grau I, 70% em H2O, especialmente purificado para uso como um fixador de microscopia electrónica ou outra utilização sofisticado. Sinônimo: solução de dialdeído glutárico, pentano-1,5-discagem. Frasco de 10ML. Referência: ****/Sigma..
Lote 128: LABORATORIO DIDATICO MOVEL. Solução de extração de rna a base de guanidina, trizol. Frasco com 200ml. MARCA: SIGMA-ALDRICH. Conforme Justificativa Técnica..
Lote 129: LABORATORIO DIDATICO MOVEL. Solução padrão de condutividade 147µS/cm +/- 0,7µS/cm, temperatura de referência 25 oC, com certificado de análise. Frasco com 500mL..
Lote 130: =99.0%. Frasco de 100G. Referência: ****. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 131: LABORATORIO DIDATICO MOVEL. Sulfato de estreptomicina purissima, Testado em Cultura Celular Vegetais, frasco com 25 gramas..
Lote 132: LABORATORIO DIDATICO MOVEL. SuperScript® III One-Step RT-PCR System with Platinum® Taq High Fidelity. Catalog ****. Size 25 reactions..
Lote 133: LABORATORIO DIDATICO MOVEL. Taq dna polymerase recombinant Conc. (5U/ul) com 500 unidades. MARCA: INVITROGEN. Conforme Justificativa Técnica..
Lote 134: LABORATORIO DIDATICO MOVEL. Tetraciclina, antibiótico. Frasco de 01 Grama..
Lote 135: LABORATORIO DIDATICO MOVEL. Tiouréia PA, frasco com 100 gramas..
Lote 136: =98% (Cacodylic trihidrato de sal de ácido de sódio). Frasco com 10G. Referência: ****/Sigma..
Lote 137: LABORATORIO DIDATICO MOVEL. Tripsina de pâncreas de bovino (Trypsin from bovine pancreas). Frasco de 0,1mg. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.
Lote 138: LABORATORIO DIDATICO MOVEL. Triptona, frasco 500G..
Lote 139: LABORATORIO DIDATICO MOVEL. Tris (trihidroximetilamino metano) base - PA - Frasco com 250 gramas. MARCA: SIGMA-ALDRICK. Conforme Justificativa Técnica..
Lote 140: LABORATORIO DIDATICO MOVEL. Tris ultrapuro, para biologia molecular. Frasco com **** gramas. MARCA: SIGMA-ALDRICH. Conforme Justificativa Técnica..
Lote 141: LABORATORIO DIDATICO MOVEL. Trizol Reagent, frasco de 100ml..
Lote 142: LABORATORIO DIDATICO MOVEL. Tungstato de Sódio (Na2WO4 · 2H2O). Frasco de 100G. Adequado para preparação de filtrados livres de proteínas de acordo com o método de Folin. OBS: Material a ser entregue no seguinte endereço: Núcleo em Ecologia e Desenvolvimento Sócio - Ambiental de Macaé (NUPEM/UFRJ) /Universidade Federal do Rio de Janeiro (UFRJ). Avenida São José do Barreto, 764 (atrás do Centro de Convenções) São José do Barreto, Macaé/RJ. CEP: ****.

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.