Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Oligonucleotideo |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

MG: SECRETARIA DE ESTADO DA SAUDE - UNIDADE DE COMPRAS-FUNED

Tubo para equipamento de laboratório; insumo; reagentes e produtos químicos ( Base de oligonucleotídeos)

Lote 3: BASE DE OLIGONUCLEOTIDEOS - ASPECTO: PO LIOFILIZADO OU LIQUIDO; APRESENTACAO: EN NMOL OU MICROMOL; FINALIDADE: AMPLIFICACAO REGIOES ESPECIFICAS MOLECULAS DE DNA; / BASE DE OLIGONUCLEOTIDEOS - ASPECTO: PO LIOFILIZADO OU LIQUIDO; APRESENTACAO: EN NMOL OU MICROMOL; FINALIDADE: AMPLIFICACAO REGIOES ESPECIFICAS MOLECULAS DE DNA;

BA ( SALVADOR ): SECRETARIA DA SAUDE/ FUNDO ESTADUAL DE SAUDE - LABORATORIO CENTRAL GONCALO MUNIZ - LACEN

AQUISICAO DE OLIGONUCLEOTIDEOS SONDA

Lote 1: OLIGONUCLEOTIDEO OLIGONUCLEOTIDEO ( Sonda 16S rRNA - 23 bases - CY5), com sequencia 5- CY5- CA CGA GCT GAC GAC AR* C CAT GCA- BHQ (* R = A ou G)- 3 end. ( 65. 05. 19. ****- 6)
Lote 2: OLIGONUCLEOTIDEO OLIGONUCLEOTIDEO ( Sonda KPC 23 bases - FAM), com sequencia 5 FAM- TG ATA ACG CCG CCG CCA ATT TGT- BHQ - 3 end. ( 65. 05. 19. ****- 0)
Lote 3: OLIGONUCLEOTIDEO OLIGONUCLEOTIDEO ( Sonda NDM - 17 bases - HEX), com sequencia 5 HEX- TG GAT CAA GCA GGA GAT- BHQ- 3 end. ( 65. 05. 19. ****- 6)

PR ( CURITIBA ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE FEDERAL DO PARANÁ/PRÓ-REITORIA DE ADMINISTRAÇÃO/DEPARTAMENTO DE SERVIÇOS GERAIS/HOSPITAL DE CLÍNICAS (UASG: 153808)

Implantação de sistema de registro de preços, com vigência de doze meses, para aquisição parcelada, conforme necessidade, de insumos laboratoriais ( colchicina cristalina e outros). O objeto atenderá o Complexo Hospital de Clínicas da UFPR, conforme especificações detalhadas constantes em edital e anexos.

Lote 25: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 25 NMOL.

PA ( BELÉM ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE FEDERAL DO PARÁ/PRÓ REITORIA DE ADMINISTRAÇÃO/DEPARTAMENTO DE RECURSOS MATERIAIS (UASG: 153063)

Aq. de material de consumo laboratorial para área de biologia molecular.

Lote 26: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MTAMZ_ f_ L Sequência: ATGCCTGATCCATGCTGT Escala: 50nmol Purificação: HPLC.
Lote 27: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MTAMZ_ r_ L Sequência: CAGCACTTGCAGGCTTAG Escala: 50nmol Purificação: HPLC.
Lote 28: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MTAMZ_ f_ O2 Sequência: CTCCAAGGGAGACTGCAAAGG Escala: 25nmol Purificação: DST.
Lote 29: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MTAMZ_ r_ O2 Sequência: AGTTCTTGGCGCAGTCATCAG Escala: 25nmol Purificação: DST.
Lote 30: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MTAMZ_ f_ O1 Sequência: TCCAAGGGAGACTGCAAAGG Escala: 25nmol Purificação: DST.
Lote 31: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MTAMZ_ r_ O1 Sequência: GTTCTTGGCGCAGTCATCAG Escala: 25nmol Purificação: DST.
Lote 32: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): RBCLMLR_ f_ O2 Sequência: TCCAGCAACGGGAGTTATCG Escala: 25nmol Purificação: DST.
Lote 33: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): RBCLMLR_ r_ O2 Sequência: TTCGAGCCCAATGTGCCATA Escala: 25nmol Purificação: DST.
Lote 34: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): RBCLMLR_ f_ O5 Sequência: GGTCCAGCAACGGGAGTTAT Escala: 25nmol Purificação: DST.
Lote 35: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): RBCLMLR_ r_ O5 Sequência: CGAGCCCAATGTGCCATACT Escala: 25nmol Purificação: DST.
Lote 36: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): RBCLMLR_ f_ O4 Sequência: ACGGGAGTTATCGTTGAGCG Escala: 25nmol Purificação: DST.
Lote 37: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): RBCLMLR_ r_ O4 Sequência: TCGAGCCCAATGTGCCATAC Escala: 25nmol Purificação: DST.
Lote 38: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): CATLAMZ_ f_ O7 Sequência: TGGACACTTGTCCTTCCAGC Escala: 25nmol Purificação: DST.
Lote 39: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): CATLAMZ_ r_ O7 Sequência: TGCTCTTGTTCCTGGTGAGC Escala: 25nmol Purificação: DST.
Lote 40: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): AAMIAMZ_ f_ O10 Sequência: CAGCTGGAACCTACTGCGAG Escala: 25nmol Purificação: DST.
Lote 41: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): AAMIAMZ_ r_ O10 Sequência: GCAGATAGCGAAGACGGGTT Escala: 25nmol Purificação: DST.
Lote 42: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): TRIPAMZ_ f_ O7 Sequência: GGAGGAAGCCGATTCCCATT Escala: 25nmol Purificação: DST.
Lote 43: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): TRIPAMZ_ r_ O7 Sequência: ACAGGAGTGGTACCTTCCGA Escala: 25nmol Purificação: DST.
Lote 44: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MMRAMZ_ f_ O2_ S1 Sequência: AGACGCAATGTTCAGCGGTA Escala: 25nmol Purificação: DST.
Lote 45: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MMRAMZ_ r_ O2_ S1 Sequência: TTGTGGTCGCCGTAAGTGAA Escala: 25nmol Purificação: DST.
Lote 46: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MMRAMZ_ f_ O5_ S2 Sequência: GTGCACTGCAACATTCCTCG Escala: 25nmol Purificação: DST.
Lote 4: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Tubos do tipo eppendorff - Microtubo para PCR 0, 2ml. Cx/ mil Tubo cônico para PCR ( inclui tampa chata), descartável, volume de 0, 2 mililitros, marca SSI, com as seguintes características: - Incolor, em resina de grau médico ( polipropileno puro); - Volume: 0, 2 ml; - Autoclavável; - Adequado para PCR em tempo real - tampa transparente ; - Testado por lote e certificado: ausência de nucleases ( DNase e RNase), DNA, pirogênios e inibidores de PCR; - Embalagem: 01 pacote com **** tubos..

SC ( ARAQUARI ): MINISTÉRIO DA EDUCAÇÃO/SECRETARIA EXECUTIVA/SUBSECRETARIA DE PLANEJAMENTO E ORÇAMENTO/INSTITUTO FEDERAL DE EDUCAÇÃO, CIENCIA E TECNOLOGIA CATARINENSE/CAMPUS ARAQUARI (UASG: 158459)

Registro de Preços para eventual aquisição de reagentes biológicos para atender às necessidades do Instituto Federal Catarinense Campus Araquari.

Lote 60: JOGO DE FERRAMENTA. Oligonucleotídeos dessalinizados 50 nmol Oligonucleotídeos liofilizados ( primers) dessanilizados, escala de síntese 50 nmol. Sequências de bases variadas. Uso em reações de PCR. Apresentação: par de bases nucleotídicas. Total: 5. 000 bp..

Estatísticas |

Número de licitações mapeadas com o termo "Oligonucleotideo"

O Licita Já faz mapeamento estatístico e analisa os maiores compradores de seus produtos e serviços!


Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
Política de privacidade | © 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.