Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599

(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |

Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |

O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Ptge |

Atualizado em 10/06/2017. Acesse também licitações mais recentes e baixe os editais.


Aquisição de Materiais Permanentes, Ferramentas e afins.

Lote 97: CHOCADEIRA. Chocadeira elétrica: automática com capacidade para 100 ovos de galinha; confeccionada em polietileno reciclável, tampa em ptge cristal transparente; temperatura com controle elétrico em alta precisão; tensão: 127 volts; complemento: confeccionada em polietileno reciclável, permitindo a assepsia após a eclosão dos ovos; com controle automático de viragem dos ovos e controle de umidade..


Aquisição de Oligonucleotídeos.

Lote 61: Oligonucleotídeos Iniciadores nas sequencias na Concentração de: 25 nmol (vinte cinco nanomoles) Grau de Pureza: normal, dessalinizado PTGES2F 5- CCAGTATTACAGGAGTGACCCAG -3.
Lote 62: Oligonucleotídeos Iniciadores nas sequencias na Concentração de: 25 nmol (vinte cinco nanomoles) Grau de Pureza: normal, dessalinizado PTGES2R 5- CTCCTACAGGAAAGTGCCCA -3.
Lote 63: Oligonucleotídeos Iniciadores nas sequencias na Concentração de: 25 nmol (vinte cinco nanomoles) Grau de Pureza: normal, dessalinizado PTGES2R 5- ACCAGGTAGGTCTTGAGGGC -3.
Lote 64: Oligonucleotídeos Iniciadores nas sequencias na Concentração de: 25 nmol (vinte cinco nanomoles) Grau de Pureza: normal, dessalinizado PTGESF 5- ATGAGTACACGAAGCCGAGG -3.


Aquisição de material de consumo para pesquisa, tais como: mix de sondas, sondas taqman, kit de extração de DNA, enzimas, etc.

Lote 9: DOSADOR QUIMICO. Sonda tecnologia Taqman para PCR em Tempo Real do gene HUMANO PTGES3 (prostaglandin E synthase 3 cytosolic) para 250 reações marcado com FAM-MGB (Item 04 SAMAM 075/2016).


Aquisição de material Permanente.

Lote 101: CHOCADEIRA. CHOCADEIRA ELÉTRICA: automática com capacidade para 50 ovos de galinha; confeccionada em polietileno reciclável, tampa em ptge cristal transparente; temperatura com controle elétrico em alta precisão; tensão: 127 volts; complemento: confeccionada em polietileno reciclável, permitindo a assepsia após a eclosão dos ovos; com controle automático de viragem dos ovos e controle de umidade..

Assista ao Vídeo |

O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!

Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
Política de privacidade | © 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.