Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Purification |

Atualizado em 25/02/2017. Acesse também licitações mais recentes e baixe os editais.

31/01/2017 - SP ( CAMPINAS ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/SECRETARIA DE DEFESA AGROPECUÁRIA/COORDENAÇÃO GERAL DE APOIO LABORATORIAL/LABORATÓRIO NACIONAL AGROPECUÁRIO - LANAGRO/SP (UASG: 130102)

Repetição do pregão para aquisição de kits de biologia molecular - grupo 161, em proveito do lanagro sp.

Lote 5: ANALISADOR - PEÇA/COMPONENTE. KIT PARA PURIFICAÇÃO DE DNA ACCUPREP GEL PURIFICATION KIT, MARCA BIONEER, PARA PURIFICAÇÃO A PARTIR DE GEL DE AGAROSE EM COLUNAS ADAPTÁVEIS A MICROTUBOS DE MICROCENTRIFUGA, KIT 50 REAÇÕES, CAT Nº ****. FAZ-SE NECESSARIA A AQUISIÇÃO DESTA MARCA COMERCIAL POR SER A ÚNICA VALIDADA NO LANAGRO-SP PARA ESTE TESTE. A AQUISIÇÃO DE OUTRA MARCA IMPLICARIA NA NECESSIDADE DE REVALIDAÇÃO DA TECNICA COM CONSEQUENTE INTERRUPÇÃO DA ROTINA LABORATORIAL POR TEMPO INDETERMINADO..

18/01/2017 - RO ( PORTO VELHO ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/CENTRO DE PESQUISA AGROFLORESTAL DE RONDÔNIA (UASG: 135001)

Aquisição de reagentes de uso laboratorial, visando atender a demanda dos laboratórios da Embrapa Rondônia.

Lote 126: MEDIDOR LABORATÓRIO. Kit PureLink® PCR Purification. Produto específico da marca Invitrogen código ****.

29/12/2016 - DF ( BRASÍLIA ): COMPANHIA DE ÁGUA E ESGOTO DE BRASÍLIA - CAESB (UASG: 974200)

Registro de Preços para aquisição de peças sobressalentes e acessórios originais/genuínas para manutenção dos cloradores de fabricação Serve Trente Water Purification, INC, instalados na Estação de Tratamento de Água ETA RDE 001 da Caesb.

Lote 1: PEÇAS/ACESSÓRIOS BOMBA DOSADORA / HIDRÁULICA. Registro de Preços para aquisição de peças sobressalentes e acessórios originais/genuínas para manutenção dos cloradores de fabricação Serve Trente Water Purification, INC, instalados na Estação de Tratamento de Água ETA RDE 001 da Caesb..

21/12/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos de uso laboratorial, tais como: high sensitivity, oligonucleotídeos, testes, kits Elisa, etc.

Lote 11: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, Probe S. mansoni P01, 1 mole Purificação: HPLC Purification Sequência P01: 56-FAMN/TCGTTGTATCTCCGAAACCACTGGACG/3BHQ, ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 03 SAPAR 029/2016).
Lote 14: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, Probe ACTB P1, 1 mole Purificação: HPLC Purification Sequência ACTB P1: HEX/CCTGCGTCTGGACCTGGCTG/3BHQ ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 06 SAPAR 029/2016).

21/12/2016 - PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de insumos laboratoriais, tais como: Kits, reagentes, testes, enzimas, etc. Destinados as seções de pesquisa do IEC. Atende TR: SAPAT 32/2016; SAPAR 10, 31, 52/2016; SABMI 02/2016; SAMAM 166/2016

Lote 28: DOSADOR QUIMICO. Kit para purificação de DNA Wizard Genomic DNA purification Kit . Designado para isolar o DNA de diversos tipos de amostras biológicas, entre eles células de sangue e tecidos. Cada Kit contém reagentes para isolar o DNA genômico e inclui, entre outros: solução de lise celular, solução de lise nucléica, solução de precipitação protéica, solução de reidratação do DNA e solução de RNAse A. Kit contendo 500 reações. Kit Wizard Genomic DNA purification Kit ou produto similar que ssegure os mesmos padrões acima referidos. Atende item 3 do TR SAPAR 31/2016..

Estatísticas |

Número de licitações mapeadas com o termo "Purification"

O Licita Já faz mapeamento estatístico e analisa os maiores compradores de seus produtos e serviços!


Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.