Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Purification |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de materiais para uso laboratoriais, tais como: histoplasma, immy, microplacas, oligonucleotídeos, ácido nítrico, tampão, BD, soro fetal bovino, bases nucleotídicas, POP 7, etanol, jit multiflex, etc. Atende SBC s SABMI 024 e 072/2017; SAMAM 101/2017; SAPAR 027 e 042/2017; SAVIR 009, 066, 069, 088 e 100/2017; SEMIE 012/2017, conforme condições, quantidades e exigências estabelecidas no Edital e seus anexos.

Lote 35: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. BigDye® XTerminator(tm) Purification Kit ou similar. Cj de reagentes para purificação de reações de sequenciamento desenvolvido para remover incorporações do kit de sequenciamento BigDye® terminator e sais. Caso esses produtos não sejam removidos pode haver interferência na injeção de amostras e basecalling. Suficiente para ~100 - 20 L de reação. Atende item 5 do TR SAVIR 69/2017..

PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de material de uso laboratorial, tais como placas, estantes plásticas, placa petri, caixa, papel filtro, pipeta, microplacas, kits, Agar, etc. (atende aos SBC SABMI 16, 25, 45, 54, 55, 57, 58, 59, 68 e 71/2017), conforme condições, quantidades e exigências estabelecidas no Edital e seus anexos.

Lote 25: ACESSÓRIOS PARA ESTUDO/TREINAMENTO. Big Dye X Terminator . Purification Kit com 20mL Suficiente para purificar **** reações de 20µL. Marca Applied Biosystems. Catálogo nº ****.(SBC SABMI 59/2017-ITEM 04).
Lote 50: ACESSÓRIOS PARA ESTUDO/TREINAMENTO. Bigdye x terminator purification kit. marca applied biosystems. kit para 100 reações.(SBC SABMI 71/2017-ITEM 19).

PA ( BELÉM ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE FEDERAL DO PARÁ/PRÓ REITORIA DE ADMINISTRAÇÃO/DEPARTAMENTO DE RECURSOS MATERIAIS (UASG: 153063)

O presente Pregão tem por objeto a Aquisição de MATERIAIS DE CONSUMO específicos da área de Biologia Molecular, para o Laboratório de Genética Aplicada, para utilização em atividades de pesquisa na Universidade Federal do Pará Campus Universitário de Bragança. São eles: REAGENTES, MATERIAL DE CONSUMO EM GERAL, MATERIAL LABORATORIAL para atender às necessidades da UFPA, tipo menor preço, conforme especificações e quantitativos contidos nos Anexo I, deste Edital. Em caso de divergência entre as especificações

Lote 7: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Kit de extração de DNA: Wizard® Genomic DNA Purification Kit.

PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de oligonucleotídeos e outros reagentes para a seção de parasitologia. Atende SBC s SAPAR nº 006, 008, 017, 018, 025, 061 e 063/2017, conforme condições, quantidades e exigências estabelecidas neste Edital e seus anexos

Lote 17: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. OLIGONUCLEOTIDEO,IDT, Probe S. mansoni P01, 1 mole Purificação: HPLC Purification Sequência P01: 56-FAMN/TCGTTGTATCTCCGAAACCACTGGACG/3BHQ ou similar que garanta o mesmo padrão de qualidade e eficiência na reação Atende item 3 do TR SAPAR 17/2017..
Lote 20: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. OLIGONUCLEOTIDEO,IDT, Probe ACTB P1, 1 mole Purificação: HPLC Purification Sequência ACTB P1: HEX/CCTGCGTCTGGACCTGGCTG/3BHQ ou similar que garanta o mesmo padrão de qualidade e eficiência na reação Atende item 6 do TR SAPAR 17/2017..

MG ( SÃO JOÃO DEL REI ): MINISTÉRIO DA EDUCAÇÃO/FUNDAÇÃO UNIVERSIDADE FEDERAL DE SÃO JOÃO DEL-REI - UFSJ (UASG: 154069)

Aquisição de materiais farmacológicos, de uso veterinário, laboratorial e hospitalar não adquiridos em pregões anteriores.

Lote 68: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. KIT GENOMIC DNA PURIFICATION 500 REACOES - KIT PARA PURIFICACAO DE DNA.

Estatísticas |

Número de licitações mapeadas com o termo "Purification"

O Licita Já faz mapeamento estatístico e analisa os maiores compradores de seus produtos e serviços!


Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
Política de privacidade | © 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.