Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Reacoes |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

RJ ( RIO DE JANEIRO ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/EMBRAPA/CTAA (UASG: 135020)

Aquisição de Reagentes para o Laboratório de Diagnóstico Molecular da Embrapa Agroindústria de Alimentos

Lote 4: ISOLADOR SUPORTE. Oligonucleotideos com 25 bases ( A, C, G ou T) sem modificações, desalinizados para uso em reação em cadeia da polimerase ( PCR) Condução de reações para detecção de indicadores de qualidade de café. Oligonucleotídeos sem marcação, escala 200 mM, dessanilizados: Hh_ gaba1_ F1 - CTTATGTCTTTCATCGTGTATCGACTA Hh_ gaba1_ R1 - AGGTGAGCTTGGCGTGAGA Hh_ gaba2_ F2 - ATCTTATGTCTTTCATCGTGTATCGACTA Hh_ gaba2_ R2- AGGTGAGCTTGGCGTGAGA Bt- F1- GAGGAAATGCGTATTCAATTCAAC Bt- R TTCTGGACTGCGAACAATGG Pubi- F2 - ATTTGCTTGGTACTGTTTCTTTTG Cry- rr- R - TTGTTGTCCATGGATCCTCTAGAGT.

RJ ( RIO DE JANEIRO ): MINISTÉRIO DA DEFESA/COMANDO DO EXÉRCITO/COMANDO MILITAR DO LESTE/1ª REGIÃO MILITAR/INSTITUTO DE BIOLOGIA DO EXÉRCITO (UASG: 160324)

Material pesquisa e biodefesa

Lote 90: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Kit para avaliação quantitativa e qualitativa de DNA total humano e total masculino em reação única, por PCR em tempo real. Limite de detecção de 6pg/ uL. Genes alvo RPPH1 ( amplicon de 140 bases) e SRY ( amplicon de 130 bases). Deve Incluir tampão, mix de primers humanos e padrão de DNA humano. Aplicação em amostras de swabs bucais, sangue, sêmen, tecidos e outras fontes. Tecnologia TaqMan® real- time PCR. Suficiente para 400 reações. Deve ser Compatível, impreterivelmente, com o equipamento do laboratório ( StepOne Plus® Applied Biosystems) do fabricante THERMOFISHER..
Lote 91: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Sistema otimizado para amplificação de 17 locais específicos para a identificação de equinos. Reação multiplex em quatro cores ( 6- FAM , VIC, NED e PET), permitindo a co- amplificação simultânea dos seguintes marcadores: VHL20, HTG4, AHT4, HMS7, HTG6, AHT5, HMS6, ASB23, ASB2, HTG10, HTG7, HMS3, HMS2, ASB17, LEX3, HMS1, CA425. O kit deve conter: Tampão master mix, 25 mM MgCl2, Mix de dNTP, AmpliTaq Gold® DNA Polymerase, controle positivo de DNA, Padrão de tamanho, Escada alélica, Mix de primers, e Água deionizada. Compatível com os equipamentos ABI 310/ **** do fabricante THERMOFISHER e suficiente para 100 reações..
Lote 92: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Sistema otimizado para amplificação de 10 locais específicos para a identificação de espécies caninas. Reação multiplex em três cores ( FAM , JOE e NED), permitindo a co- amplificação simultânea dos seguintes marcadores: PEZ 1, FHC ****, FHC2010, PEZ 5, PEZ 20, PEZ 12, PEZ 3, PEZ 6, PEZ 8, FHC ****. O kit deve conter: Tampão master mix, 25 mM MgCl2, Mix de dNTP, AmpliTaq Gold® DNA Polymerase, controle positivo de DNA, Padrão de tamanho, Escada alélica, Mix de primers, e Água deionizada. Compatível com os equipamentos ABI 310/ **** do fabricante THERMOFISHER., suficiente para 100 reações..
Lote 126: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Tampão para pré- tratamento de amostras biológicas coletadas em papel de filtro FTA. Promove a lise e elimina possíveis inibições da reação. Frasco suficiente para 200 reações.
Lote 127: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Tampão para pré- tratamento de amostras biológicas coletadas em papel de filtro FTA. Promove a lise e elimina possíveis inibições da reação. Frasco suficiente para **** reações.
Lote 133: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Kit para amplificação de 30 polimorfismos inserção/ deleção ( INDELs) incluindo Amelogenina. Aplicável para análise de DNA altamente degradado, com tamanho máximo de amplicon de 150 bp. O kit deverá incluir mix de primers, mix de reação, Taq DNA polimerase, controle positivo de DNA humano, padrão de tamanho e escada alélica do fabricante QIAGEN. Suficiente para 100 reações..
Lote 137: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Purficação enzimática de produtos de PCR, com fosfatase alcalina e exonuclease I ( EXO/ SAP) combinadas em reação única de 30 minutos. Frasco suficiente para 100 reações..
Lote 138: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Purficação enzimática de produtos de PCR, com fosfatase alcalina e exonuclease I ( EXO/ SAP) combinadas em reação única de 30 minutos. Frasco suficiente para 500 reações..

PE ( PETROLINA ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/EMBRAPA/CPATSA (UASG: 135012)

Reagentes, Vidrarias e Materiais de Laboratorio

Lote 40: ACESSÓRIOS PARA ESTUDO/ TREINAMENTO. DNTP set, conjunto de 4 tubos de 250 µ L na concentração de 100mM ( dATP, dCTP, dGTP, dTTP). Uso em PCR e transcrição reversa. O conjunto de dNTP 100 mM consiste em quatro desoxinucleótidos ( dATP, dCTP, dGTP, dTTP), cada um com uma concentração de 100 mM. Os desoxinucleótidos são adequados para utilização na reação em cadeia da polimerase ( PCR), seqüenciamento, preenchimento, tradução de nick, síntese de cDNA e reações de retaguarda TdT. Os nucleotídeos são fornecidos como soluções prontas para uso. Concentração: 100 mM Tamanho do produto: 4 x 250 L Condição de Envio: Envio congelado / GELO SECO / - 20 GRAU.

PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de materiais para uso laboratoriais, tais como: histoplasma, immy, microplacas, oligonucleotídeos, ácido nítrico, tampão, BD, soro fetal bovino, bases nucleotídicas, POP 7, etanol, jit multiflex, etc. Atende SBC s SABMI 024 e 072/2017; SAMAM 101/2017; SAPAR 027 e 042/2017; SAVIR 009, 066, 069, 088 e 100/2017; SEMIE 012/2017, conforme condições, quantidades e exigências estabelecidas no Edital e seus anexos.

Lote 35: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. BigDye® XTerminator(tm) Purification Kit ou similar. Cj de reagentes para purificação de reações de sequenciamento desenvolvido para remover incorporações do kit de sequenciamento BigDye® terminator e sais. Caso esses produtos não sejam removidos pode haver interferência na injeção de amostras e basecalling. Suficiente para ~100 - 20 L de reação. Atende item 5 do TR SAVIR 69/2017..

MG ( JUIZ DE FORA ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE FEDERAL DE JUIZ DE FORA (UASG: 153061)

Aquisição de material químico e laboratorial para atender a Universidade Federal de Juiz de Fora - Campus de Juiz de Fora e de Governador Valadares - MG.

Lote 263: EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS. REAGENTES EM KIT PARA SÍNTESE DE DNA COMPLEMENTAR CDNA (50 REAÇÕES). FLUXO DE TRABALHO CONVENIENTE E FÁCIL COM POUCOS PASSOS DE PIPETAGEM; TRANSCRIÇÃO REVERSA CONFIÁVEL E PROTOCOLO DE 2 PASSOS OTIMIZADO E FLEXÍVEL, PERMITINDO MÚLTIPLAS REAÇÕES DE PCR A PARTIR DE UMA ÚNICA REAÇÃO DE TRANSCRIÇÃO REVERSA..
Lote 291: EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS. REAGENTE DE GENOTIPAGEM TAQMANGTXPRESS MIX. COMBINA POLIMERASE DE DNA RÁPIDA AMPLITAQ, UP, DNTPS, TINTURA DE RASTREAMENTO E CORANTE ROX EM UM FRASCO ÚNICO. O PACOTE DE 1 ML (2 X 50ML) INCLUI REAGENTES SUFICIENTES PARA REALIZAR 400 REAÇÕES DE PCR (5UL/REAÇÃO). COMPATÍVEL COM CONDIÇÕES DE CICLO TÉRMICO DE MODO RÁPIDO E PADRÃO. VALIDADOS COM TODOS OS TIPOS DE ENSAIOS DE GENOTIPAGEMTAQMAN DA APPLIEDBIOSYSTEMS..

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
Política de privacidade | © 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.