Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Taa |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

SP: SEC. SAÚDE/COORDENADORIA DE CONTROLE DE DOENÇAS/CENTRO DE REFERÊNCIA E TREINAMENTO- DST/AIDS

Compra de material de marcenaria/TABUAS, COMPENSADOS DE MADEIRA, ESQUADRIAS E PORTAS DE MADEIRA, FERRO/TABUAS, GUARNICOES, ARTIGOS CORRELATOS A BASE DE MADEIRA E BATENTES D

Lote 6: cmpensado de fibra de madeira prensada (MDF) com espessura de 15 mm, taamnh9o 2,75 x 1,84

29/05/2017 - DF: INFRAERO - EMPRESA BRASILEIRA DE INFRAESTRUTURA AEROPORTUÁRIA

Contratação dos serviços de vigilância armada e desarmada, nas dependências do Aeroporto Internacional de Belém/Val-de-Cans/Júlio César Ribeiro (SBBE), Aeroporto de Belém/Brigadeiro Potássio de Oliveira (SBJC), Aeroporto de Marabá/João Corrêa da Rocha (SBMA), Aeroporto de Santarém/Maestro Wilson Fonseca (SBSN) e Aeroporto de Altamira (SBHT); das Estações Prestadoras de Serviços de Telecomunicações e de Tráfego Aéreo de Tucuruí (TATU), Itaituba (TAIH), Jacareacanga (TAEK), Conceição do Araguaia (TAAA) e Mont

29/05/2017 - DF: EMPRESA BRASILEIRA DE INFRA-ESTRUTURA AEROPORTUARI /(1) CENTRO DE SUPORTE ADMINISTRATIVO DE BRASÍLIA/CSBR

Contratação dos serviços de vigilância armada e desarmada, nas dependências do Aeroporto Internacional de Belém/Val-de-Cans/Júlio César Ribeiro (SBBE), Aeroporto de Belém/Brigadeiro Potássio de Oliveira (SBJC), Aeroporto de Marabá/João Corrêa da Rocha (SBMA), Aeroporto de Santarém/Maestro Wilson Fonseca (SBSN) e Aeroporto de Altamira (SBHT); das Estações Prestadoras de Serviços de Telecomunicações e de Tráfego Aéreo de Tucuruí (TATU), Itaituba (TAIH), Jacareacanga (TAEK), Conceição do Araguaia (TAAA) e Mont

Lote 1: Contratação dos serviços de vigilância armada e desarmada, nas dependências do Aeroporto Internacional de Belém/Val-de-Cans/Júlio César Ribeiro (SBBE), Aeroporto de Belém/Brigadeiro Potássio de Oliveira (SBJC), Aeroporto de Marabá/João Corrêa da Rocha (SBMA), Aeroporto de Santarém/Maestro Wilson Fonseca (SBSN) e Aeroporto de Altamira (SBHT); das Estações Prestadoras de Serviços de Telecomunicações e de Tráfego Aéreo de Tucuruí (TATU), Itaituba (TAIH), Jacareacanga (TAEK), Conceição do Araguaia (TAAA) e Monte Dourado (TAMD); e da Unidade Técnica de Aeronavegação de Porto de Moz (UTA-MOZ)

13/04/2017 - RJ ( RIO DE JANEIRO ): MINISTÉRIO DA SAÚDE/FUNDAÇÃO OSWALDO CRUZ/INSTITUTO OSWALDO CRUZ (UASG: 254463)

Aquisição de material biológico conforme Edital e Termo de Referência.

Lote 62: ADAPTADOR. PRIMER DE DNA PERSONALIZADO (OLIGOLIOFILIZADO), OLOGONUCLEOTÍDEO: Dloop3-1x - 25 nmol, SEQUÊNCIA: 5, TAACCGCTGCTGCTGGCACAA-3`, ESCALA DE SÍNTESE: 25 NMOL, TIPO DE PURIFICAÇÃO: PADÃO, QUANTIDADE DE BASES: 21. Código: ****.
Lote 63: ADAPTADOR. PRIMER DE DNA PERSONALIZADO (OLIGOLIOFILIZADO), OLOGONUCLEOTÍDEO: Dloop4-1x - 25 nmol, SEQUÊNCIA: 5, TAACCCTTTATTCAGGCAT-3`, ESCALA DE SÍNTESE: 25 NMOL, TIPO DE PURIFICAÇÃO: PADRÃO, QUANTIDADE DE BASES: 19. Código: ****.

07/04/2017 - RJ ( NITERÓI ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE FEDERAL FLUMINENSE/PRÓ-REITORIA DE PESQUISA, PÓS-GRADUAÇÃO E INOVAÇÃO (PROPPI) (UASG: 153248)

Aquisição de MATERIAL BIOLÓGICO E MEIOS DE CULTURA

Lote 111: SOLVENTE. MGF - f 5 TAACCCTTCATCACCTCATCTAGAG3 (Para PCR e eletroforese -Primers em escala de 200 nm).

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
Política de privacidade | © 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.