Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Tta |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

PA ( ANANINDEUA ): MINISTÉRIO DA SAÚDE/SECRETARIA DE VIGILÂNCIA EM SAÚDE/INSTITUTO EVANDRO CHAGAS - IEC (UASG: 257003)

Aquisição de oligonucleotídeos e outros reagentes para a seção de parasitologia. Atende SBC s SAPAR nº 006, 008, 017, 018, 025, 061 e 063/2017, conforme condições, quantidades e exigências estabelecidas neste Edital e seus anexos

Lote 14: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Frasco contendo síntese de oligonucleotídeos (100nmol), totalizando 20 bases, conforme nome e sequência fornecida a seguir: NC2 Reverse 5´-TTAGTTTCTTTTCCTCCGCT-3´ Atende item 4 do TR SAPAR 08/2017..

04/05/2017 - RJ: MINISTÉRIO DA SAÚDE/FUNDAÇÃO OSWALDO CRUZ/ESCOLA NACIONAL DE SAÚDE PÚBLICA SÉRGIO AROUCA (UASG: 254450)

Aquisição de Oligonucleotídeos.

Lote 53: Oligonucleotídeos Iniciadores nas sequencias na Concentração de: 25 nmol (vinte cinco nanomoles) Grau de Pureza: normal, dessalinizado LTC4SF4 5- TTACCTGGGCTCGGAAGAC -3.

13/04/2017 - RJ ( RIO DE JANEIRO ): MINISTÉRIO DA SAÚDE/FUNDAÇÃO OSWALDO CRUZ/INSTITUTO OSWALDO CRUZ (UASG: 254463)

Aquisição de material biológico conforme Edital e Termo de Referência.

Lote 43: ADAPTADOR. PRIMER DE DNA PERSONALIZADO (OLIGO LIOFILIZADO), OLIGONUCLEOTÍDEO:OC623 , SEQUÊNCIA: 5 `TTAAGGTTTTTTTTGGACTTTCTGC 3`, ESCALA DE SÍNTESE: 25 nmol, TIPO DE PURIFICAÇÃO: DESSALINIZADA, NÚMERO DE BASES: 25. Código: ****.

13/03/2017 - RS ( PORTO ALEGRE ): CORSAN - COMPANHIA RIOGRANDENSE DE SANEAMENTO-RS

AQUISIÇÃO DE QUADROS DE COMANDO – TIPO TTA – COM ACIONAMENTO POR CHAVE DE PARTIDA SUAVE (SOFT-STARTER) PARA MOTORES DA EBE-1 E EBE-2 COM SERVIÇO DE INSTALAÇÃO PARA A SITEL.

10/03/2017 - PR: COPEL COMPANHIA PARANAENSE DE ENERGIA /(1) SUP. DE LOGISTICA DE SUPRIMENTO - SLS

Fornecimento de materiais para a manutenção das linhas, redes e subestações dos complexos CBP e SBE, em 27 lotes. Observar que a partir do lote 4 até o 27 são exclusivo para participação de ME/EPP e MEI. ESTA LICITAÇÃO SUBSTITUI A DE NÚMERO BB - ID ****, POIS O SITE DO BANCO DO BRASIL NÃO PERMITE ALTERAR O TRATAMENTO APLICADO AOS LOTES, QUANDO JÁ EXISTEM PROPOSTAS CADASTRADAS PARA A LICITAÇÃO.

Lote 10: Lote 10 - Código Copel ****; CONECT,TERMIN;PRESS;1CABOXBARRA;2F;FLINT; Descricao: Conector terminal de pressao,cabo x barra,cabo Flint, 2 furos,1 condutor; Aplicacao: para 1 cabo de aluminio; Material:liga de aluminio; Cabo:Flint (740,8 MCM); Furacao: 2 furos NEMA; Componentes: parafusos sextavados, porcas e arruelas de aco zincado a fogo; Tipo de fixacao: por pressao atraves de parafusos; Tensao de aplicacao: 138 KV; Ref. NAR42A-2N Burndy; EF-71AL2N Delta Star, TTAC **** Intelli, TLC 42A 2N NEMA, TBB 83 2N Polimetal ou similar.

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
Política de privacidade | © 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.