Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599

(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |

Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |

O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Tubo Tca |

Atualizado em 27/05/2017. Acesse também licitações mais recentes e baixe os editais.


Eventual aquisição de Reagentes para Laboratório, para o Instituto Federal de Educação, Ciência e Tecnologia Catarinense Campus Concórdia.

Lote 188: REAGENTE PARA TINTA. Par de Primers (iniciadores) para amplificação de DNA de B-actina por PCR convencional. Um par de frascos contendo cada primer, 25 nmoles de concentração, liofilizados, em tubos com rosca. Nome do primer e sequências: B-actin Fwd: 5 - TCAAGGAGAAGCTCTGCTACGTG-3´ B-actin Rev: 5´-TTGCCGATGGTGATGACCT-3 ..


Registro de preços para futura e eventual aquisição de peças para manutenção de viatura e um trator agrícola para atender as necessidades do 47¨ Batalhão de Infantaria, Coxim, MS,






Contratação de empresa para fornecimento de peças de motor (engrenagem, flexível de lubrificação, serpentina do compressor, válvula de retenção, anéis, juntas, carcaça de distribuição, turbinas, bronzinas, compressores, bico injetor, reparo do cabeçote, kit do motor, porta injetor, caneta do bico, refrigerador de óleo, cárter de óleo, jogo de junta, motor compacto parcial, tubo guia da vareta do nível de óleo, turbo alimentador e parafuso central da polia), para atender a frota de ônibus da TCB Sociedade de



Aquisição de materiais de uso laboratorial, tais como: testes, oligonucleotídeos, superscript, kits, reagentes, etc.

Lote 5: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores EVP2F-P2 5 GTR CCR CCH ACA GTT GAR TCA 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 03 SAVIR 030/2016).
Lote 13: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores JV13I - 5 TCA TCA TCA CCA TAG AAI GAG 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 02 SAVIR 031/2016).
Lote 21: DOSADOR QUIMICO. Síntese de Oligonucleotídeos iniciadores P270 - 5 TCAGATGCATTGTCATTGGT 3 . Escala 100 nmol. O produto deve conter as seguintes características técnicas (e/ou especificações equivalentes): oligonucleotídeos com alto rendimento (Relação da escala de síntese x rendimento final); alta pureza; livres de sal; analisados por espectrometria de massa; presença de bases modificadas; presença de tubo rotulado com: nome e sequencia do oligo, temperatura de melting, peso molecular, concentração em namoles (nmol) e micrograma, tamanho, conteúdo GC%, densidade óptica-absorbância, escala de produção. (Item 10 SAVIR 031/2016).

Estatísticas |

Número de licitações mapeadas com o termo "Tubo Tca"

O Licita Já faz mapeamento estatístico e analisa os maiores compradores de seus produtos e serviços!

Assista ao Vídeo |

O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!

Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.