Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Oligonucleotideos |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

RS ( SANTA MARIA ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE FEDERAL DE SANTA MARIA (UASG: 153164)

REGISTRO de PREÇOS PARA AQUISIÇÃO DE PRODUTOS QUÍMICOS DESTINADOS AOS DIVERSOS SETORES DA UFSM.

Lote 709: COMPOSTO PRESERVATIVO. Master Mix para PCR em tempo real com corante SYBR® GreenER TM contendo todos os componentes de reação menos a amostra e oligonucleotídeos iniciadores. Frasco com 5 ml..
Lote 936: COMPOSTO PRESERVATIVO. Oligonucleotídeos, tamanho 20 bases, aplicação reação de PCR. Características adicionais: especialmente preparado, pode conter bases degeneradas e inosina, escala 25 nmol..

SP: SEC.DESENV. ECONOMICO, CIENCIA,TECN. INOVACA UNICAMP-CAISM

MATERIAL DE USO LABORATORIAL

Lote 3: OLIGONUCLEOTIDEOS 26 BASES B23
Lote 4: OLIGONUCLEOTIDEOS 20 BASES RTG1
Lote 5: OLIGONUCLEOTIDEOS 25 BASES B22
Lote 6: OLIGONUCLEOTIDEOS 20 BASES RTG2
Lote 7: OLIGONUCLEOTIDEOS 20 BASES HL1 512PB
Lote 8: OLIGONUCLEOTIDEOS 20 BASES HL2 512PB
Lote 9: OLIGONUCLEOTIDEOS 18 BASES P3
Lote 10: OLIGONUCLEOTIDEOS 21 BASES P5
Lote 11: OLIGONUCLEOTIDEOS 20 BASES G73
Lote 12: OLIGONUCLEOTIDEOS 20 BASES G74
Lote 15: OLIGONUCLEOTIDEOS INICIADORES 25 BASES MIE4 25 NANOMOLES PO LIOFILIZ.
Lote 16: OLIGONUCLEOTIDEOS INICIADORES 25 BASES MIE5 25 NANOMOLES PO LIOFILIZ.
Lote 17: OLIGONUCLEOTIDEOS INICIADORES 20 BASES IE1 25 NANOMOLES PO LIOFILIZ.
Lote 18: OLIGONUCLEOTIDEOS INICIADORES 20 BASES IE2 25 NANOMOLES PO LIOFILIZ.

SP: SEC. DESENVOLVIMENTO ECONÔMICO, CIÊNCIA, TECNOLOGIA E INOVAÇAO/UNIV.ESTADUAL DE CAMPINAS - UNICAMP/UNIVERSIDADE ESTADUAL DE CAMPINAS-UNICAMP

Registro de preços de reagentes para rotina diagnostica/EQUIPAMENTOS E ARTIGOS DE USO MEDICO, ODONTOLOGICO, HOSPITALAR E LABORATORIAL/REAGENTES QUIMICOS E BIOLOGICOS

Lote 3: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 26 Bases; Po Liofilizado, B23; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 Tgg Gtc Tac Gtc Gat Ggc Atg Aca Ac; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 4: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Rtg1; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 Ggc Att Cct Cgt Tga Aga Tt; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 5: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 25 Bases; Po Liofilizado, B22; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 Aac Ggg Cga Gta Gca Cct Gag Gag A; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 6: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Rtg2; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 Cct Tgg Ccg Ata Ggt Cta Gg; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 7: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Hl1 512pb; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 TAGAGATAGGAAACCAACTC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 8: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Hl2 512pb; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CTCGGGTTAATGTTGCATGA; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 9: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 18 Bases; Po Liofilizado, P3; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 AGA CAG AGA AGA CTC TTG; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 10: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 21 Bases; Po Liofilizado, P5; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 TCA TTC GTC TGT TTC CCA TTC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 11: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, G73; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 GAA GAG CCA AGG ACA GGT AC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 12: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, G74; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CAA CTT CAT CCA CGT TCA CC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 15: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 25 Bases; Po Liofilizado, Mie4; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CCA AGC GGC CTC TGA TAA CCA AGC C; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 16: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 25 Bases; Po Liofilizado, Mie5; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CAG CAC CAT CCT CCT CTT CCT CTG G; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 17: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Ie1; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CCA CCC GTG GTG CCA GCT CC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 18: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Ie2; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CCC GCT CCT CCT GAC CAC CC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****

RS ( BENTO GONÇALVES ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/EMBRAPA/CNPUV (UASG: 135033)

Registro de Preços para aquisição de materiais laboratoriais de forma eventual e parcelada, para a Embrapa Uva e Vinho.

Lote 13: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 200 NMOL.

PR ( TOLEDO ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE TECNOLÓGICA FEDERAL DO PARANÁ/CAMPUS DE TOLEDO (UASG: 150150)

Eventual aquisição de material laboratorial, reagentes químicos e biológicos, destinados às aulas práticas dos cursos da UTFPR - Câmpus Toledo.

Lote 36: OLIGONUCLEOTÍDEOS. OLIGONUCLEOTÍDEOS, APLICAÇÃO REAÇÃO DE PCR, CARACTERÍSTICAS ADICIONAIS ESPECIALMENTE PREPARADO, CARACTERÍSTICA ADICIONAIS ESCALA 50 NMOL.

Estatísticas |

Número de licitações mapeadas com o termo "Oligonucleotideos"

O Licita Já faz mapeamento estatístico e analisa os maiores compradores de seus produtos e serviços!


Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
Política de privacidade | © 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.