Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 3211-5055 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! Licitação Simples.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Primers |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

DF ( BRASÍLIA ): MINISTÉRIO DA EDUCAÇÃO/FUNDAÇÃO UNIVERSIDADE DE BRASÍLIA/DECANATO DE ADMINISTRAÇÃO E FINANÇAS (UASG: 154040)

Aquisição de Produtos Biológicos para Laboratórios destinados ao atendimento das necessidades de diversos Centros de Custo da Universidade de Brasília, de acordo com a tabela Especificações constante no Termo de Referência, na forma de Sistema de Registro de Preços.

Lote 156: LABORATORIO DIDATICO MOVEL. Taq DNA Polimerase: Kit de enzima para reação de PCR Taq DNA Polymerase, isolada de Thermus aquaticus YT1. A enzima consiste de um único polipeptídeo com peso molecular de aproximadamente 94 kDa, termoestável para sintetizar DNA em altas temperaturas a partir de protocolo padrão na presença de oligonucleotídeos (primers). Concentração de 5 U/µL. Caixa contém Taq DNA Polymerase 100 U (20 µL); Tampão para PCR sem MgCl2 na concentração de 10X (1.25 mL) e Cloreto de Magnésio (MgCl2) a 50 mM (1 mL)..

SC ( CHAPECÓ ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE FEDERAL DA FRONTEIRA SUL (UASG: 158517)

REGISTRO DE PREÇOS, visando a eventual Aquisição de Materiais para Manutenção que destinam-se ao atendimento das demandas por materiais de manutenção e reparo, para o período de **** nos 6 Campi da UFFS para serviços vinculados a SEO-DMA, COORDENAÇÕES ADMINISTRATIVAS DOS CAMPI, SELAB e ÁREAS EXPERIMENTAIS prevendo uma reserva Técnica para Emergências no Almoxarifado Central, conforme condições, quantidades e exigências estabelecidas no Edital e seus anexos.

Lote 148: ACESSÓRIOS PARA ESTUDO/TREINAMENTO. ITEM - Lixa d´água, n¨ 80 ESPECIFICAÇÃO TÉCNICA - Feita a partir de resinas e de papel impermeável, utilizada para lixamento úmido em geral e lixamento de superfícies metálicas e de materiais compostos, como massas plásticas, massas rápidas e primers. Unidade medindo 225 mm X 275 mm, Grana 80.

PI ( TERESINA ): MINISTÉRIO DA EDUCAÇÃO/FUNDAÇÃO UNIVERSIDADE FEDERAL DO PIAUÍ (UASG: 154048)

Registro de Preços para aquisição de reagentes de uso cotidiano para manutenção das atividades básicas dos laboratórios didáticos da Universidade Federal do Piauí, conforme especificações, condições, quantidades e exigências estabelecidas no instrumento, pelo período de 12 meses.

Lote 315: ACESSÓRIOS PARA ESTUDO/TREINAMENTO. Primers Anaplasma spp. Primers são segmentos de ácidos nucleicos, compostos por nucleotídeos, como sequência complementar de DNA, utilizados para início da replicação do DNA. Sequência de nucleotídeos: gE3a (5 -CACATGCAAGTCGAACGGATTATTC-3 ) e gE10R (5 -TTCCGTTAAGAAGGATCTAATCTCC-3 ). Tamanho do produto para PCR: 932 bp. Apresentação: Material liofilizado e desproteinizado. O produto deverá ser entregue com no mínimo 75% da sua data de validade. Ficha de Informação de Segurança de Produto Químico (FISPQ). Possuir Registro:ANVISA/MINISTÉRIO DA SAÚDE..
Lote 316: ACESSÓRIOS PARA ESTUDO/TREINAMENTO. Primers Ehrlichia spp.Primers são segmentos de ácidos nucleicos, compostos por nucleotídeos, como sequência complementar de DNA, utilizados para início da replicação do DNA. Sequência de nucleotídeos: ECC (5´-GAACGAACGCTGGCGGCAAGC-3´) e ECB (5´-CGTATTACCGCGGCTGCTGGCA-3´). Tamanho do produto para PCR: 478 bp. Apresentação: Material liofilizado e desproteinizado. O produto deverá ser entregue com no mínimo 75% da sua data de validade. Ficha de Informação de Segurança de Produto Químico (FISPQ). Possuir Registro:ANVISA/MINISTÉRIO DA SAÚDE..
Lote 317: ACESSÓRIOS PARA ESTUDO/TREINAMENTO. Primers Hepatozoon sp.Primers são segmentos de ácidos nucleicos, compostos por nucleotídeos, como sequência complementar de DNA, utilizados para início da replicação do DNA. Sequência de nucleotídeos: HepF (5´-ATACATGAGCAAAATCTCAAC-3´) e HepR (5´-CTTATTATTCCATGCTGCAG-3´). Tamanho do produto para PCR: 666 bp. Apresentação: Material liofilizado e desproteinizado. O produto deverá ser entregue com no mínimo 75% da sua data de validade. Ficha de Informação de Segurança de Produto Químico (FISPQ). Possuir Registro:ANVISA/MINISTÉRIO DA SAÚDE..
Lote 318: ACESSÓRIOS PARA ESTUDO/TREINAMENTO. Primers L. Donovani ComplexPrimers são segmentos de ácidos nucleicos, compostos por nucleotídeos, como sequência complementar de DNA, utilizados para início da replicação do DNA. Sequência de nucleotídeos: MC1 (5´-GTTAGCCGATGGTGGTCTTG-3´) e MC2 (5´-CACCCATTT TTCCGA TTT TG-3´). Tamanho do produto para PCR: 447 bp. Apresentação: Material liofilizado e desproteinizado. O produto deverá ser entregue com no mínimo 75% da sua data de validade. Ficha de Informação de Segurança de Produto Químico (FISPQ). Possuir Registro:ANVISA/MINISTÉRIO DA SAÚDE..
Lote 319: ACESSÓRIOS PARA ESTUDO/TREINAMENTO. Primers Leishmania spp.Primers são segmentos de ácidos nucleicos, compostos por nucleotídeos, como sequência complementar de DNA, utilizados para início da replicação do DNA. Sequência de nucleotídeos: L1 (5´-GGGGAGGGGCGTTCTGCGAA-3´) e L2 (5´-GGCCCACTATATTACACCAACCCC-3 ). Tamanho do produto para PCR: 120 bp. Apresentação: Material liofilizado e desproteinizado. O produto deverá ser entregue com no mínimo 75% da sua data de validade. Ficha de Informação de Segurança de Produto Químico (FISPQ). Possuir Registro:ANVISA/MINISTÉRIO DA SAÚDE..
Lote 320: ACESSÓRIOS PARA ESTUDO/TREINAMENTO. Primers Nested Anaplasma spp Primers são segmentos de ácidos nucleicos, compostos por nucleotídeos, como sequência complementar de DNA, utilizados para início da replicação do DNA. Sequência de nucleotídeos: gE2 (5 -GGCAGTATTAAAAGCAGCTCCAGG-3 ) e gE9f (5 -AACGGATTATTCTTTATAGCTTGCT-3 . Tamanho do produto para PCR: 546 bp. Apresentação: Material liofilizado e desproteinizado. O produto deverá ser entregue com no mínimo 75% da sua data de validade. Ficha de Informação de Segurança de Produto Químico (FISPQ). Possuir Registro:ANVISA/MINISTÉRIO DA SAÚDE..
Lote 321: ACESSÓRIOS PARA ESTUDO/TREINAMENTO. Primers Nested Babesia spp.Primers são segmentos de ácidos nucleicos, compostos por nucleotídeos, como sequência complementar de DNA, utilizados para início da replicação do DNA. Sequência de nucleotídeos: BTF2 (5´-CCGTGCTAATTGTAGGGCTAATAC-3´) e BTR2 (5´-GGACTACGACGGTATCTGATCG-3´). Tamanho do produto para PCR: 800 bp. Apresentação: Material liofilizado e desproteinizado. O produto deverá ser entregue com no mínimo 75% da sua data de validade. Ficha de Informação de Segurança de Produto Químico (FISPQ). Possuir Registro:ANVISA/MINISTÉRIO DA SAÚDE..
Lote 322: ACESSÓRIOS PARA ESTUDO/TREINAMENTO. Primers Nested E. Primers são segmentos de ácidos nucleicos, compostos por nucleotídeos, como sequência complementar de DNA, utilizados para início da replicação do DNA. Sequência de nucleotídeos: ECAN-5 (5´-AATTATTTATAGCCTCTGGCTATAGGA-3´) e HE3 (5´-TATAGGTACCGTCATTATCTTCCCTAT-3´). Tamanho do produto para PCR: 358 bp. Apresentação: Material liofilizado e desproteinizado. O produto deverá ser entregue com no mínimo 75% da sua data de validade. Ficha de Informação de Segurança de Produto Químico (FISPQ). Possuir Registro:ANVISA/MINISTÉRIO DA SAÚDE..

RJ ( NITERÓI ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE FEDERAL FLUMINENSE/PRÓ-REITORIA DE PESQUISA, PÓS-GRADUAÇÃO E INOVAÇÃO (PROPPI) (UASG: 153248)

Aquisição de MATERIAL BIOLÓGICO E MEIOS DE CULTURA

Lote 102: SOLVENTE. MagF 5´-CCTTTTAGATTGGGATAGCGGATG-3´ (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 103: SOLVENTE. MagR 5´-CCGTCAAGGTAGCGTCATTTCCTAC- 3´ (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 109: SOLVENTE. MG B1: CGTGGATATCTTTAGTTCCAGCTGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 110: SOLVENTE. MG B2: GTAGCAAGTTATAATTTCCAGGCAT (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 111: SOLVENTE. MGF - f 5 TAACCCTTCATCACCTCATCTAGAG3 (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 112: SOLVENTE. MGF- r 5 CTGTTTGCTAAAGAACAAGTTGATC3 (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 113: SOLVENTE. MHP3 5 -AAGTTCATTCGCGCTAGCCC5´-3´ (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 114: SOLVENTE. MHP4 5 -GCTCCTACTCCATAT TGCCC-3´ (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 117: SOLVENTE. MS-f: GAGAAGCAAAATAGTGATATCA (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 118: SOLVENTE. MsppF1 CGCCTGAGTAGTACGTTCGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 119: SOLVENTE. MsppF2 CGCCTGAGTAGTACGTACGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 120: SOLVENTE. MsppF3 TGCCTGAGTAGTACATTCGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 121: SOLVENTE. MsppF4 TGCCTGGGTAGTACATTCGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 122: SOLVENTE. MsppF5 CGCCTGGGTAGTACATTCGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 123: SOLVENTE. MsppF6 CGCCTGAGTAGTATGCTCGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 124: SOLVENTE. MsppR1 GCGGTGTGTACAAGACCCGA (Para PCR e eletroforese -Primers em escala de 200 nm).

RJ ( NITERÓI ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE FEDERAL FLUMINENSE/PRÓ-REITORIA DE PESQUISA, PÓS-GRADUAÇÃO E INOVAÇÃO (PROPPI) (UASG: 153248)

Aquisição de MATERIAL ODONTOLOGICO

Lote 116: CIMENTO REFRATÁRIO. CIMENTO RESINOSO AUTOPOLIMERIZÁVEL - com fotopolimerização adicional, autocondicionante através de uso de primersa autocondicionantes, para fixação adesiva de restaurações feitas de metal, metalocerâmicas, cerâmica pura e compósitos, além de pinos intrarradiculares feitos de metal, cerâmica e compósitos reforçados por fibras. O tamanho médio das partículas do cimento deve ser de 0,9 µm e o volume total de partículas inorgânicas de 39% a 40%. Embalagem em kit com: seringa dupla com pontas de auto-mistura; 01 frasco de silano com moléculas de 10-MDP (10-metacriloxidecildi-hidrogênio fosfato); 01 seringa double de cimento autopolimerizável de cor transparente; 01 sistema adesivo autocondicionante..

Estatísticas |

Número de licitações mapeadas com o termo "Primers"

O Licita Já faz mapeamento estatístico e analisa os maiores compradores de seus produtos e serviços!


Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 3211-5055
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.