Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599

(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |

Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |

O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Pregão Eletrônico Edital: 104/2016- Ananindeua Pa |

Atualizado em 19/09/2016. Acesse também licitações mais recentes e baixe os editais.


Aquisição de materiais diversos para pesquisas, tais como: soro bovino fetal, soro de cabra, bases nucleotídicas, bicarbonato, kits, oligonucletídeos, etc.

Lote 1: DOSADOR QUIMICO. Soro Normal de cabra (Normal Goat serum) frascos com 500mL **** Lot: **** (Item 01 SABMI 009/2016).
Lote 2: DOSADOR QUIMICO. Tetrametilbenzidine _TMB Frascos com 500 mL (Item 02 SABMI 009/2016).
Lote 3: DOSADOR QUIMICO. Anticorpo IgA anti-Humana ( - Chain specific)- Peroxidase produzido em cabra. Frascos de 1 mL (Item 03 SABMI 009/2016).
Lote 4: DOSADOR QUIMICO. Bases nucleotídicas para confecção de primers , escala inicial de 50 nMol. (Item 01 SABMI 039/2016).
Lote 5: DOSADOR QUIMICO. GN teste Kit Vitek 2-Gram Negativo,Embalagem com 20 Cartões (Item 01 SABMI 092/2016).
Lote 6: DOSADOR QUIMICO. AST-GN 238 /104KIT VITEK 2 Teste de sensibilidade de Gram Negativo com 20 cartões (Item 02 SABMI 092/2016).
Lote 7: DOSADOR QUIMICO. AST-GN 239 /104KIT VITEK 2 Teste de sensibilidade de Gram Negativo com 20 cartões (Item 03 SABMI 092/2016).
Lote 8: DOSADOR QUIMICO. Tubos do Vitek 2 **** mm Referência ****, **** unidades (Item 04 SABMI 092/2016).
Lote 9: DOSADOR QUIMICO. Padrão de Calibração para Equipamentos Densichek Vitek 2 referência **** (Item 05 SABMI 092/2016).
Lote 10: DOSADOR QUIMICO. Solução Salina Frasco com **** ml Vitek 2 (Item 06 SABMI 092/2016).
Lote 11: DOSADOR QUIMICO. Soro Bovino Fetal de alta performance, Certificado pela ISO ****. Com níveis de endotoxinas menor ou igual a 5 EU/mL. Com níveis de hemoglobina igual ou abaixo de 10mg/mL. Frasco com 500mL. Marca GIBCO (****), ou similar. (Item 01 SAMAM 051/2016).
Lote 12: DOSADOR QUIMICO. Soro Bovino Fetal sem exossomos. Com depleção de mais de 90% de exossomos endógenos. Frasco com 500 mL. Marca Gibco (catálogo ****) ou similar. (Item 02 SAMAM 051/2016).
Lote 13: DOSADOR QUIMICO. Bicarbonato Amônio (CH5NO3). Forma de apresentação: 2 frascos com 50g cada. (Item 01 SAMAM 058/2016).
Lote 14: DOSADOR QUIMICO. Glycine, Molecular Biology Grade para análise proteômica. Forma de apresentação: 2 Frascos com 500g cada. (Item 02 SAMAM 058/2016).
Lote 15: DOSADOR QUIMICO. Kit de Purificação e Extração de DNA. Caixa para 100 isolamentos. (Item 03 SAMAM 058/2016).
Lote 16: DOSADOR QUIMICO. Pure Yield Plasmid Miniprep. Caixa para 100 isolamentos. (Item 04 SAMAM 058/2016).
Lote 17: DOSADOR QUIMICO. Soil master DNA Extraction. Caixa para 100 extrações (Item 05 SAMAM 058/2016).
Lote 18: DOSADOR QUIMICO. Fenol para análise molecular ultrapuro. pH 10 +/- 0,02; Forrma de apresentação: 2 frasco com 50ml cada. (Item 06 SAMAM 058/2016).
Lote 19: DOSADOR QUIMICO. 2 Mercaptoethanol. Forma de apresentação: 2 frascos com 500ml cada. (Item 07 SAMAM 058/2016).
Lote 20: DOSADOR QUIMICO. Cloroformio ultrapuro para analise molecular. pH 7,5 - 7,8. 2 - 8¨C; Forma de apresentação: 2 frascos com **** cada. (Item 08 SAMAM 058/2016).
Lote 21: DOSADOR QUIMICO. Cyclohexamide. Forma de apresentação: 1 frasco com 50g. (Item 09 SAMAM 058/2016).
Lote 22: DOSADOR QUIMICO. Kit de conversão de DNA por bissulfito, com taxa de conversão de citosinas de até 99%. Kit para 48 preparações Marca de Referência: QIAGEN (Catálogo ****) ou similar (Item 01 SAMAM 077/2016).
Lote 23: DOSADOR QUIMICO. kit para a limpeza e concentração rápida de DNA ultra-puro de grandes dimensões (genômico, mitocondrial, plasmídeo (BAC / PAC), viral, fago, DNA de WGA), etc) a partir de qualquer reação enzimática ou preparação Kit para 100 preparações . Marca de Referência: Zymo Research (Catálogo ****) ou similar. (Item 02 SAMAM 077/2016).
Lote 24: DOSADOR QUIMICO. Kit de Purificação para produtos de PCR. Kit para 250 preparações Marca de Referência: Invitrogen (Catálogo ****) ou similar. (Item 03 SAMAM 077/2016).
Lote 25: DOSADOR QUIMICO. Kit de extração de DNA para tecidos parafinizados. Kit para 100 preparações Marca de Referência: Promega (Catálogo ****) ou similar (Item 04 SAMAM 077/2016).
Lote 26: DOSADOR QUIMICO. Kit de extração de DNA genômico de Tecidos. Kit para 250 preparações Marca de Referência: Promega ou similar. (Item 05 SAMAM 077/2016).
Lote 27: DOSADOR QUIMICO. Kit de Purificação de DNA a partir de extração de Sangue. Kit para 250 preparações Marca de Referência: Invitrogen (Catálogo ****) ou similar (Item 06 SAMAM 077/2016).
Lote 28: DOSADOR QUIMICO. Kit para extração de RNA, através da técnica de eluição em coluna de sílica gel. Conteúdo do Kit para 250 extrações. Descrição do Kit SV Total RNA Isolation System conjunto de reagentes indicado para purificação de RNA total de amostras de tecido, cultura de células e sangue. Método baseado no uso membrana em mini colunas. Inclui etapa de tratamento com DNAse, reduzindo contaminação com DNA genômico. O kit é composto por: tubos de coleta, água livre de nuclease, tubos de eluição, tampão de lise, tampão de eluição, solução de lavagem, DNAse I, solução de inibição da ação da DNAse, tampão amarelo, cloreto de manganês, colunas e solução de beta mercaptoetanol. Para 250 preparações. (Item 01 SAMAM 149/2016).
Lote 29: DOSADOR QUIMICO. KITS ELISA (Ensaio imunoenzimático) para detecção de IgM anti- T. gondii- pelo método de imunocaptura, com reagentes prontos para uso. Kit para 96 testes. (Item 01 SAPAR 056/2016).
Lote 30: DOSADOR QUIMICO. KITS ELISA (Ensaio imunoenzimático) para detecção de IgG anti- T. gondii- pelo método indireto. Com reagentes prontos para uso; cinco calibradores (0, 10, 50, 100, 200 UI/ML). Kit para 96 testes. (Item 02 SAPAR 056/2016).
Lote 31: DOSADOR QUIMICO. Oligonucleotídeo para Diagnóstico de Malária Humana: P1- 5 ACG ATC AGA TAC CGT CGT AAT CTT 3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 01 SAPAR 064/2016).
Lote 32: DOSADOR QUIMICO. Oligonucleotídeo para Diagnóstico de Malária Humana: P2- 5 GAA CCC AAA GAC TTT GAT TTC TCA T 3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 02 SAPAR 064/2016).
Lote 33: DOSADOR QUIMICO. Oligonucleotídeo para Diagnóstico de Malária Humana: F2- 5 CAA TCT AAA AGT CAC CTC GAA AGA TG 3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 03 SAPAR 064/2016).
Lote 34: DOSADOR QUIMICO. Oligonucleotídeo para Diagnóstico de Malária Humana: V1- 5 CAA TCT AAG AAT AAA CTC CGA AGA GAA A 3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 04 SAPAR 064/2016).
Lote 35: DOSADOR QUIMICO. Oligonucleotídeo para Diagnóstico de Malária Humana: M1- 5 GGA AGC TAT CTA AAA GAA ACA CTC ATA T 3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 05 SAPAR 064/2016).
Lote 36: DOSADOR QUIMICO. Enzima Taq DNA Polimerase frasco com 500 unidades (5U/uL). A Taq DNA polimerase é indicada para aplicações que requerem síntese de DNA em alta temperatura; catalisa a polimerização dos nucleotídeos em DNA duplex na direção 5 -3 na presença de MgCl2 mas mantém a atividade exonuclease 3 -5 . Taq DNA Polimerase é fornecido com um tampão de Taq 10X de reação (200 mM Tris pH 8,4, KCl 500 mM) e um tubo de 50 mM de MgCl 2. Aspecto líquido; Concentração 5 g/ l. (Item 06 SAPAR 064/2016).
Lote 37: DOSADOR QUIMICO. Marcador de pares de bases; tipo Track It 100 pb DNA ladder 100 APPLS. TrackIt 100 pb DNA Ladder (0,1ug/µL) em 10 mM de Tris-HCL (pH 7,5), EDTA 10 mM (pH 8,0), 0,06% XCFF, 0,6% tartrazina, e 5% de glicerol. Faixa de tamanho de 0,1 a 1,5 kb e uma faixa adicional de **** pb. Pronto para carregar em géis de agarose e estável a temperatura ambiente. (Item 07 SAPAR 064/2016).
Lote 38: DOSADOR QUIMICO. Kit de extração e purificação do DNA genômico de até 50 kb. Uso em PCR; Volume de eluição de **** µl; formato de coluna de spin; purificação rápida de alta qualidade, de DNA pronto para uso; consistentes e altos rendimentos; com remoção completa de contaminantes e inibidores. Ideal para o processamento de 250 amostras. (Item 08 SAPAR 064/2016).
Lote 39: DOSADOR QUIMICO. Oligonucleotídeo para Diagnóstico de Malária Humana: rPLU5- 5 CCTGTTGTTGCCTTAAACTTC 3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 01 SAPAR 068/2016).
Lote 40: DOSADOR QUIMICO. Oligonucleotídeo para Diagnóstico de Malária Humana: rPLU6- 5 TTAAAATTGTTGCAGTTAAAACG 3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 02 SAPAR 068/2016).
Lote 41: DOSADOR QUIMICO. Oligonucleotídeo para Diagnóstico de Malária Humana: rFAL1- 5 TTAAACTGGTTTGGGAAAACC AAATATATT 3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 03 SAPAR 068/2016).
Lote 42: DOSADOR QUIMICO. Oligonucleotídeo para Diagnóstico de Malária Humana: rFAL2- 5 ACACAATGAACTCAATCATGA CTACCCGTC 3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 04 SAPAR 068/2016).
Lote 43: DOSADOR QUIMICO. Oligonucleotídeo para Diagnóstico de Malária Humana: rVIV1- 5 CGCTTCTAGCTTAATCCACAT AACTGATAC 3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 05 SAPAR 068/2016).
Lote 44: DOSADOR QUIMICO. Oligonucleotídeo para Diagnóstico de Malária Humana: rVIV2- 5 ACTTCCAAGCCGAAGCAAAGA AAGTCCTTA 3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 06 SAPAR 068/2016).
Lote 45: DOSADOR QUIMICO. Oligonucleotídeo para Diagnóstico de Malária Humana: rMAL1- 5 ATAACATAGTTGTACGTTAAG AATAACCGC 3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 07 SAPAR 068/2016).
Lote 46: DOSADOR QUIMICO. Oligonucleotídeo para Diagnóstico de Malária Humana: rMAL2- 5 AAAATTCCCATGCATAAAAAA TTATACAAA 3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Deve apresentar garantia de pureza e 100% QC por espectrometria de massa por ionização com eletrospray. O rendimento mínimo na escala de 100nM deve ser de 4-6 OD. Acondicionado em frasco com tampa de rosca; Rotulado com numero de lote, data de fabricação, validade, composição e procedência; Certificação análise. (Item 08 SAPAR 068/2016).
Lote 47: DOSADOR QUIMICO. Conjunto de desoxinucleotideos, 100 mM. Fornecido com 04 tubos de DNTPs individuais para PCR de rotina; permite a otimização das concentrações de dNTP individuais; 1,0 mL de cada um de dATP 100 mM, dCTP, dGTP e dTTP. (Item 09 SAPAR 068/2016).
Lote 48: DOSADOR QUIMICO. Taq Platinum DNA polimerase. Estável a temperatura ambiente. Especificidade: hot start cinética de reduzir o emparelhamento inespecífico do iniciador, melhorando o rendimento do produto. Usada para produtos de PCR até 10kb. Possui uma atividade de transferase terminal não dependente do molde que adiciona uma desoxiadenina, e tem uma atividade exonuclease 5 3 . Quantidade para 120 reações. (Item 10 SAPAR 068/2016).
Lote 49: DOSADOR QUIMICO. QIAamp MinElute Virus Spin Kit (50). Para uso no Extrator QIAcube (Prazo de validade mínimo de 12 meses a contar da data de entrega). (Item 01 SAVIR 075/2016).
Lote 50: DOSADOR QUIMICO. QIAquick Gel Extraction Kit (250). Para uso no Extrator QIAcube (Prazo de validade mínimo de 12 meses a contar da data de entrega). (Item 02 SAVIR 075/2016).
Lote 51: DOSADOR QUIMICO. QIAamp Viral RNA Mini Kit (250). Para uso no Extrator QIAcube (Prazo de validade mínimo de 12 meses a contar da data de entrega). (Item 03 SAVIR 075/2016).
Lote 52: DOSADOR QUIMICO. Soro fetal Bovino, cerificado, origem EUA. Frasco com 500ml.Filtragem tripla em 0.1 micron (validade superior a 12 MESES) Baixo nível de endotoxina e hemoglobinas Nível de Endotoxina: 5 EU/ml Nível de Hemoglobina: 10 mg/dl Origen: United States GIBCO. CAT. **** ou com caracteristica similares *Especificações Técnicas: O licitante deverá verificar o edital. (Item 01 SAVIR 085/2016).
Lote 53: DOSADOR QUIMICO. Penicilina-streptomicina líquida, frasco com 100ml , Cat. ****, Invitrogen (prazo de validade superior ou igual a 12 meses) (Item 02 SAVIR 085/2016).

Assista ao Vídeo |

O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!

Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
Política de privacidade | © 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.