Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Pregão Eletrônico Edital: 12/2016 Processo: 43/2016 Nº 24279 |

Atualizado em 04/10/2016. Acesse também licitações mais recentes e baixe os editais.

04/10/2016 - PE: LABORATORIO CENTRAL DE SAUDE PUBLICA - DR. MILTON BEZERRA SOBRAL - LACEN-PE

Aquisição de reagentes e insumos para os testes de biologia molecular e cultura de células dos diagnósticos da influenza e dengue

Lote 1: **** - REAGENTE PARA BIOLOGIA MOLECULAR - INIBIR CONTAMINACAO POR RNASE E DNASE,EMBALAGEM APROPRIADA PARA O PRODUTO,ROTULO N: LOTE, DATA FABRICACAO/VALIDADE, PROCEDENCIA, ESTOCAGEM E BULA.,INIBIDOR DE RNASE E DNASE DE ORIGEM QUIMICA
Lote 2: **** - REAGENTE PARA BIOLOGIA MOLECULAR - AGAROSE PARA GEL DE ELETROFORESE DE DNA, FRASCO COM 100 GRAMAS, MAXIMA, TEMPERATURA AMBIENTE, NR.LOTE,DATA DE FABRICACAO/VALIDADE, PROCEDENCIA, MTHFR
Lote 3: **** - REAGENTE PARA BIOLOGIA MOLECULAR - TAMPAO TBE 10X (ULTRA PURO), SOLUCAO ESTERIL, FILTRADO DE 1M TRIS 0,9 M ACIDO BORICO E 0,001 EDTA, LIVRE DE ATIVIDADE DE DNASE, RNASE E PROTEASE, ACONDICIONADO EM EMBALAGEM APROPRIADA, ROTULO C/N.LOTE, DATA DE FABRICACAO/VALIDADE E PROCEDENCIA
Lote 4: **** - REAGENTE PARA BIOLOGIA MOLECULAR - ETANOL ABSOLUTO, COM TEOR DE PUREZA DE 200, ACONDICIONADO EM FRASCO COM 500 ML, ROTULO CONTENDO DATA DE FABRICACAO/VALIDADE, PROCEDENCIA, ESTOCAGEM E BULA
Lote 5: **** - SOLUCAO - PARA REMOVER ACIDOS NUCLEICOS DE SUPERFICIES E EQUIPAMENTOS DE LABORATORIOS DE BIOLOGIA MOLECULAR,DNA-EXITUSPLUS (****),ACONDICIONADO EM EMBALAGEM APROPRIADA,ROTULO COM N. DE LOTE, DATA DE FABRICACAO/VALIDADE, PROCEDENCIA, ESTOCAGEM E BULA
Lote 6: **** - REAGENTE PARA BIOLOGIA MOLECULAR - TAQ DNA POLIMERASE, 500 UNIDADES, 100UL (5U/UL),TAMPAO DE INCUBACAO 10X SEM CLORETO DE MAGNESIO, 1,500UL, CLORETO DE MAGNESIO 50MM. ****, ORIGEM THERMUS AQUATICUS BM, RECOMBINANT (E.COLI), ACONDICIONADO EM EMBALAGEM APROPRIADA, ROTULO C/N.LOTE, DATA DE FABRICACAO/VALIDADE E PROCEDENCIA
Lote 7: **** - ALBUMINA BOVINA - ALBUMINA BOVINA PARA USO EM SOROLOGIA, FRACAO V, 96 A 98 % DE PUREZA, IMUNOENZIMATICO, FRASCO C/ 100 GRAMAS, DADOS DO FABRICANTE/PRODUTO,N.DO LOTE,VALIDADE
Lote 8: **** - REAGENTE PARA BIOLOGIA MOLECULAR - PARA REACAO MOLECULAR, FRASCO COM 500ML, EM EMBALAGEM APROPIADA PARA O PRODUTO, DATA DE VALIDADE, ESTOCAGEM, - AGUA ISENTA DE NUCLEASE (NUCLEASE FREE WATER)
Lote 9: **** - REAGENTE PARA BIOLOGIA MOLECULAR - PARA REACAO MOLECULAR, FRASCO COM ****, CONCENTRACAO DE 40U/UL, EM EMBALAGEM APROPIADA PARA O PRODUTO, DATA DE VALIDADE, ESTOCAGEM, - INIBIDOR DE RNASE (RNASIN OU RNASOUT)
Lote 10: **** - REAGENTE PARA BIOLOGIA MOLECULAR - PARA IDENTIFICAR O GENOMA DOS VIRUS DENGUE POR RT-PCR, FRASCO COM 50NMOL, TCAATATGCTGAAACGCGCGAGAAACCG, EM EMBALAGEM APROPIADA PARA O PRODUTO, DATA DE VALIDADE, ESTOCAGEM, - DCON1/LANCIOTTI (SEQUENCIA 5- TO 3-)
Lote 11: **** - REAGENTE PARA BIOLOGIA MOLECULAR - PARA IDENTIFICAR O GENOMA DOS VIRUS DENGUE POR RT-PCR, FRASCO COM 50NMOL, TTGCACCAACAGTCAATGTCTTCAGGTTC, EM EMBALAGEM APROPIADA PARA O PRODUTO, DATA DE VALIDADE, ESTOCAGEM, - DCON2/LANCIOTTI (SEQUENCIA 5- TO 3-)
Lote 12: **** - REAGENTE PARA BIOLOGIA MOLECULAR - PARA IDENTIFICAR O GENOMA DOS VIRUS DENGUE POR RT-PCR, FRASCO COM 50NMOL, CGTCTCAGTGATCCGGGGG, EM EMBALAGEM APROPIADA PARA O PRODUTO, DATA DE VALIDADE, ESTOCAGEM, - TS1/LANCIOTTI (SEQUENCIA 5- TO 3-)
Lote 13: **** - REAGENTE PARA BIOLOGIA MOLECULAR - PARA IDENTIFICAR O GENOMA DOS VIRUS DENGUE POR RT-PCR, FRASCO COM 50NMOL, CGCCACAAGGGCCATGAACAG, EM EMBALAGEM APROPIADA PARA O PRODUTO, DATA DE VALIDADE, ESTOCAGEM, - TS2/LANCIOTTI (SEQUENCIA 5- TO 3-)
Lote 14: **** - REAGENTE PARA BIOLOGIA MOLECULAR - PARA IDENTIFICAR O GENOMA DOS VIRUS DENGUE POR RT-PCR, FRASCO COM 50NMOL, TAACATCATCATGAGACAGAGC, EM EMBALAGEM APROPIADA PARA O PRODUTO, DATA DE VALIDADE, ESTOCAGEM, - TS3/LANCIOTTI (SEQUENCIA 5- TO 3-)
Lote 15: **** - REAGENTE PARA BIOLOGIA MOLECULAR - PARA IDENTIFICAR O GENOMA DOS VIRUS DENGUE POR RT-PCR, FRASCO COM 50NMOL, CTCTGTTGTCTTAAACAAGAGA, EM EMBALAGEM APROPIADA PARA O PRODUTO, DATA DE VALIDADE, ESTOCAGEM, - TS4/LANCIOTTI (SEQUENCIA 5- TO 3-)
Lote 16: **** - REAGENTE PARA DIAGNOSTICO - - FUNGIZON ANTIMICOTICO, CONTENDO 250 UG DE ANFOTERICINA B E 205 UG DE DEOXYCOLATO DE SODIO POR ML, COM UMA SOLUBILIZACAO EM AGUA DESTILADA, CONCENTRACAO RECOMENDADA: 0,25 TO 2,5 UG/ML, ACONDICIONADO EM EMBALAGEM APROPRIADA, ROTULO C/N.LOTE,DATA DE FABRICACAO/VALIDADE E PROCEDENCIA
Lote 17: **** - REAGENTES QUIMICOS - PENICILINA E ESTREPTOMICINA ****, CATEGORIA P.A., ACONDICIONADO EM FRASCO COM 100 ML, ROTULO COM NR. DE LOTE, DATA DE FABRICACAO/VALIDADE, FORMULA E PROCEDENCIA
Lote 18: **** - REAGENTE PARA BIOLOGIA MOLECULAR - PARA REACAO MOLECULAR, FRASCO COM 100MM, EM EMBALAGEM APROPIADA PARA O PRODUTO, DATA DE VALIDADE, ESTOCAGEM, - NUCLEOTIDEOS: DNTPS SET 100MM
Lote 19: **** - ALCOOL - ETILICO ABSOLUTO, CATEGORIA P.A., (ETANOL), COM TEOR MINIMO DE 99,8%, COM DENSIDADE DE 0,79 G/ML A 20 C, ACIDO LIVRE MAX **** %, ALCALI LIVRE MAX 0,****, RESIDUO APOS EVAPORACAO MAXINO 0,001%, COMPONENTES REDUTORES MAXINO 0,****, PB,CU,FE,ZN - MAX. 0,****; METANOL MAX. 0,05%, ACONDICIONADO EM FRASCO COM 1 LITRO, ROTULO COM NUMERO DO LOTE, DATA DE FABRICACAO, FORMULA E ORIG

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.