Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599

(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |

Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |

O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Pregão Eletrônico Edital: 31/2016- Campinas Sp |

Atualizado em 05/09/2016. Acesse também licitações mais recentes e baixe os editais.


Aquisição de Material de Biologia Molecular- MAG, em proveito do LANAGRO SP

Lote 1: MEDIDOR LABORATÓRIO. Agarose, Type I-A, grau biologia molecular, baixa eletroendosmose (low EEO). Formulação em pó; coloração branca a esbranquiçada. Eletroendosmose (-MR): 0,09 ? 0,13. Temperatura de solidificação (gel 1,5%): 34,5 ? 37,5 ºC. Força do gel (1%): maior ou igual **** gm/cm2. Sulfato menor ou igual a 0,2%. Umidade menor ou igual a 7%. Cinzas menor ou igual a 0,5%. Frasco de 500 g. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** ? Sigma..
Lote 2: MEDIDOR LABORATÓRIO. Agarose, grau biologia molecular, baixa eletroendosmose (low EEO). Formulação em pó; coloração branca a esbranquiçada. Eletroendosmose (-MR): 0,09 - 0,13. Temperatura de solidificação (gel 1,5%): 34,5 - 37,5 ºC. Força do gel (1%): maior ou igual **** gm/cm2. Sulfato menor ou igual a 0,15%. Umidade menor ou igual a 10%. Livre de DNases e RNases. Frasco com 500 g. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** - Sigma.
Lote 3: MEDIDOR LABORATÓRIO. Agente intercalante fluorescente vermelho ultrassensível para a para visualização de dsDNA, ssDNA e RNA em gel de agarose ou de poliacrilamida. Diluído **** em água. Estável em temperatura ambiente e resistente ao aquecimento por micro-ondas, perfeitamente compatível com transiluminador UV padrão ou com excitação por luz visível. Frasco com 0,5mL. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote e ficha de informação de segurança do produto químico.Com padrão de qualidade igual ou superior ao **** ? Biotium..
Lote 4: MEDIDOR LABORATÓRIO. Agente intercalante fluorescente para visualização de ácidos nucléicos em gel de agarose (natural e denaturante) e poliacrilamida. Sem requerimento de pré-lavagem ou descoloração do gel. Detecção sensível de pequenas quantidades de ácido nucléico. Compatível com transiluminador UV padrão. Estável em temperatura ambiente (maior 90 dias). Frasco com 0,5 mL de solução concentrada (****). No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote e ficha de informação de segurança do produto químico.Com padrão de qualidade igual ou superior ao Corante Diamond? Nucleic Acid Dye - ****/Promega..
Lote 5: MEDIDOR LABORATÓRIO. Água livre de nucleases, deionizada, filtrada e autoclavada, pronta para o uso em reação de PCR. Fórmula: H2O, peso molecular: 18,02 grama/mol. CAS nº. ****. Grau biologia molecular. Livre de DNase, RNase e nuclease. Não deve conter aditivos químicos como DEPC. Testada para atividades endonuclease, exonuclease e RNase. Frasco com 10 x 50 mL. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** - Qiagen.
Lote 6: MEDIDOR LABORATÓRIO. Azul de bromofenol-sódio. Indicador/corante para eletroforese, grau biologia molecular. Fórmula química ****, peso molecular 691,94 grama/mol. Formulação em pó; coloração preta. Frasco com 25 g. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** - Sigma.
Lote 7: MEDIDOR LABORATÓRIO. Bovine serum albumin (BSA), acetilada, grau biologia molecular. Livre de DNase, RNase, NICKase e protease. Formulação em pó liofilizado; coloração branca a branca esverdeada. Frasco com 25 mg. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** - Sigma.
Lote 8: MEDIDOR LABORATÓRIO. Cloreto de magnésio hexahidratado. MgCl2.6H2O, peso molecular 203,3 grama/mol, grau biologia molecular. Pureza maior ou igual 99,0%. Livre de DNAses, RNAses, proteases, fosfatases. N total menor ou igual a 0,****; Al: menor ou igual a 5 mg/Kg; As: menor ou igual a 0,1 mg/Kg; Ba: menor ou igual a 5 mg/Kg; Bi: menor ou igual a 5 mg/Kg; Ca: menor ou igual a 50 mg/Kg; Cd: menor ou igual a 5 mg/Kg; Co: menor ou igual a 5 mg/Kg; Cr: menor ou igual a 5 mg/Kg; Cu: menor ou igual a 5 mg/Kg; Fe: menor ou igual a 5 mg/Kg; K: menor ou igual a **** mg/Kg; Li: menor ou igual a 5 mg/Kg; Mn: menor ou igual a 5 mg/Kg; Mo: menor ou igual a 5 mg/Kg; Na: menor ou igual a **** mg/Kg; Ni: menor ou igual a 5 mg/Kg; Pb: menor ou igual a 5 mg/Kg; Sr: menor ou igual a 5 mg/Kg; Zn: menor ou igual a 5 mg/Kg; PO43-): menor ou igual a 5 mg/Kg; SO42-: menor ou igual a 50 mg/Kg. pH: 5,0 - 7,5 (25ºC, 1M em H2O). Frasco com 250 g. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** - Sigma.
Lote 9: MEDIDOR LABORATÓRIO. Cloreto de magnésio, solução 25 Milimolar. Solução de MgCl2, 25mM. Peso molecular 95,21 grama/mol. Grau biologia molecular, para aplicação em reação PCR. Livre de DNAses, RNAses, proteases e fosfatases. Conjunto com 5 x 1,5 mL. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao ****- Sigma..
Lote 10: MEDIDOR LABORATÓRIO. Cloreto de potássio KCL, pureza maior ou igual 99,5%, peso molecular 74,55 grama/mol, grau biologia molecular. Livre de DNAses, RNAses, proteases e fosfatases. Densidade: 1,98 g/mL a 25ºC; pH 5,0 - 8,0 (25¨C, 1M em H2O). N total: menor ou igual a 0,001%; Br: menor ou igual a 500 mg/Kg; I: menor ou igual a 20 mg/Kg; PO43-: menor ou igual a 5 mg/Kg; SO42-: menor ou igual a 30 mg/Kg; Al: menor ou igual a 5 mg/Kg; As: menor ou igual a 0,1 mg/Kg; Ba: menor ou igual a 10 mg/Kg; Bi: menor ou igual a 5 mg/Kg; Ca: menor ou igual a 50 mg/Kg; Cd: menor ou igual a 5 mg/Kg; Co: menor ou igual a 5 mg/Kg; Cr: menor ou igual a 5 mg/Kg; Cu: menor ou igual a 5 mg/Kg; Fe: menor ou igual a 2 mg/Kg; Li: menor ou igual a 5 mg/Kg; Mg: menor ou igual a 10 mg/Kg; Mn: menor ou igual a 5 mg/Kg; Mo: menor ou igual a 5 mg/Kg; Na: menor ou igual a 200 mg/Kg; Ni: menor ou igual a 5 mg/Kg; Pb: menor ou igual a 5 mg/Kg; Sr: menor ou igual a 5 mg/Kg; Zn: menor ou igual a 5 mg/Kg. Frasco com 100 mL. Frasco com 250 g. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote. Com padrão de qualidade igual ou superior ao **** - Sigma.
Lote 11: MEDIDOR LABORATÓRIO. Cloreto de potássio, solução 1M. Solução de KCl, 1M em água, peso molecular 74,55 grama/mol, grau biologia molecular. Livre de DNAses, RNAses, proteases e fosfatases. Densidade: 1,04 g/mL a 20ºC; pH 5,0 - 8,0 (25¨C, 1M em H2O). N total: menor ou igual a 0,001%;SO42-: menor ou igual a 10 mg/Kg; Al: menor ou igual a 1 mg/Kg; Ba: menor ou igual a 1 mg/Kg; Ca: menor ou igual a 5 mg/Kg; Cd: menor ou igual a 1 mg/Kg; Co: menor ou igual a 1 mg/Kg; Cr: menor ou igual a 1 mg/Kg; Cu: menor ou igual a 1 mg/Kg; Fe: menor ou igual a 1 mg/Kg; Li: menor ou igual a 1 mg/Kg; Mg: menor ou igual a 1 mg/Kg; Mn: menor ou igual a 1 mg/Kg; Mo: menor ou igual a 1 mg/Kg; Na: menor ou igual a 20 mg/Kg; Ni: menor ou igual a 1 mg/Kg; Pb: menor ou igual a 1 mg/Kg; Sr: menor ou igual a 1 mg/Kg; Zn: menor ou igual a 1 mg/Kg. Frasco com 100 mL. Frasco com 100 mL. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** - Sigma.
Lote 12: MEDIDOR LABORATÓRIO. Cloreto de sódio. Fórmula: NaCl, grau biologia molecular, pureza maior ou igual 99,5%. Livre de DNAses, RNAses, proteases e fosfatases. pH 5,0 - 8,0 (25¨C, 1M em H2O). N total: menor ou igual a 0,001%; SO42-: menor ou igual a 100 mg/Kg; PO43-: menor ou igual a 5 mg/Kg; I: menor ou igual a 10 mg/Kg; Br: menor ou igual a 50 mg/Kg; [Fe(CN)6]4-: menor ou igual a 1 mg/Kg; Al: menor ou igual a 5 mg/Kg; As: menor ou igual a 0,1 mg/Kg; Ba: menor ou igual a 5 mg/Kg; Bi: menor ou igual a 5 mg/Kg; Ca: menor ou igual a 10 mg/Kg; Cd: menor ou igual a 5 mg/Kg; Co: menor ou igual a 5 mg/Kg; Cr: menor ou igual a 5 mg/Kg; Cu: menor ou igual a 5 mg/Kg; Fe: menor ou igual a 1 mg/Kg; K: menor ou igual a 50 mg/Kg; Li: menor ou igual a 5 mg/Kg; Mg: menor ou igual a 5 mg/Kg; Mn: menor ou igual a 5 mg/Kg; Mo: menor ou igual a 5 mg/Kg; Ni: menor ou igual a 5 mg/Kg; Pb: menor ou igual a 5 mg/Kg; Sr: menor ou igual a 5 mg/Kg; Zn: menor ou igual a 5 mg/Kg. Frasco com 1 Kg. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote e ficha de informação de segurança do produto químico.Com padrão de qualidade igual ou superior ao **** - Sigma.
Lote 13: MEDIDOR LABORATÓRIO. Cloreto de sódio, solução 5M. NaCl, solução 5M em água, grau biologia molecular, pureza maior ou igual 99,5. Livre de DNAses, RNAses, proteases e fosfatases. pH: 5,0 - 7,0 (25ºC). Al: menor ou igual a 1 mg/Kg; Ba: menor ou igual a 1 mg/Kg; Bi: menor ou igual a 1 mg/Kg; Ca: menor ou igual a 5 mg/Kg; Cd: menor ou igual a 1 mg/Kg; Co: menor ou igual a 1 mg/Kg; Cr: menor ou igual a 1 mg/Kg; Cu: menor ou igual a 1 mg/Kg; Fe: menor ou igual a 1 mg/Kg; K: menor ou igual a 20 mg/Kg; Li: menor ou igual a 1 mg/Kg; Mg: menor ou igual a 1 mg/Kg; Mn: menor ou igual a 1 mg/Kg; Mo: menor ou igual a 1 mg/Kg; Ni: menor ou igual a 1 mg/Kg; Pb: menor ou igual a 1 mg/Kg; Sr: menor ou igual a 1 mg/Kg; Zn: menor ou igual a 1 mg/Kg. Frasco com 1 L. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote e ficha de informação de segurança do produto químico.Com padrão de qualidade igual ou superior ao **** ? Sigma..
Lote 14: MEDIDOR LABORATÓRIO. Descontaminador de DNA e Dnases. Solução de hidróxido alcalino, para a eliminação efetiva de contaminação de DNA e de Dnases em superfícies (aço inoxidável, plástico, vidro, entre outras). Livre de Diethylpyro-carbonate (DEPC).Solução pronta para o uso. Frasco com 250 mL. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** ? Molecular Bio-Products..
Lote 15: MEDIDOR LABORATÓRIO. Conjunto de dNTP (2´-deoxynucleoside 5´-triphosphate): dATP, dCTP, dGTP e dTTP, cada um na concentração de 100 Milimolar. Frasco 4 (250 L) x 100 Milimolar (25 mmol), em água purificada (pH 7,5). No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** Invitrogen..
Lote 16: MEDIDOR LABORATÓRIO. Dodecil sulfato de sódio (SDS), fórmula química ****, peso molecular: 288,38 grama/mol, grau biologia molecular, Pureza maior ou igual 99,0%. Formulação em pó; coloração branca a esbranquiçada. Livre de DNAses, RNAses, fosfatases, proteases, e material insolúvel. Metais pesados menor ou igual a 10 g/g; Cl menor ou igual a 200 mg/Kg; fosfato (PO43-) menor ou igual a 1 mg/Kg; Al: menor ou igual a 5 mg/Kg; Ba: menor ou igual a 5 mg/Kg; Bi: menor ou igual a 5 mg/Kg; Ca: menor ou igual a 10 mg/Kg; Cd: menor ou igual a 5 mg/Kg; Co: menor ou igual a 5 mg/Kg; Cr: menor ou igual a 5 mg/Kg; Cu: menor ou igual a 5 mg/Kg; Fe: menor ou igual a 5 mg/Kg; K: menor ou igual a 200 mg/Kg; Li: menor ou igual a 5 mg/Kg; Mg: menor ou igual a 5 mg/Kg; Mn: menor ou igual a 5 mg/Kg; Mo: menor ou igual a 5 mg/Kg; Ni: menor ou igual a 5 mg/Kg; Pb: menor ou igual a 5 mg/Kg; Sr: menor ou igual a 5 mg/Kg; Zn: menor ou igual a 5 mg/Kg. Frasco com 500 g. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote e ficha de informação de segurança do produto químico.Com padrão de qualidade igual ou superior ao **** ? Sigma..
Lote 17: MEDIDOR LABORATÓRIO. EDTA sal dissódico dihidratado, EDTA-Na2.2(H2O). CAS ****. Fórmula: ****(H2O). Peso molecular: 372,24 grama/mol, 99 ? 101% (titulação), grau biologia molecular (para uso em eletroforese). Frasco com 500 g. Pó, para utilização em biologia molecular. Livre de DNases, RNases, Nickases, Proteases. Traços: Fe menor ou igual a 0,005%; Pb menor ou igual a 0,002%. Ácido nitrilotriacético (NTA) menor ou igual a 0,1%; material insolúvel menor ou igual a 0,005%. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote. Com padrão de qualidade igual ou superior ao SIGMA ****.
Lote 18: MEDIDOR LABORATÓRIO. Lisozima (muramidase) de ovo branco de galinha, grau biologia molecular, pureza maior ou igual 98%. Para uso como agente de lise para purificação de ácido nucléico. Formulação em pó liofilizado. Proteína (UV): maior ou igual 90%. Atividade: maior ou igual **** unidades/mg. Frasco com 1 g. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote. Com padrão de qualidade igual ou superior ao **** - Sigma.
Lote 19: MEDIDOR LABORATÓRIO. Marcador de massa de DNA, composto por uma mistura equimolar de 06 (seis) fragmentos de DNA (100, 200, 400, 800, **** e **** bp). A eletroforese de 4 L do marcador deve resultar em bandas contendo 10, 20, 40, 80, 120 e 200 ng de DNA, respectivamente). Não deve conter o tampão de carregamento. Concentração: 117,5 ng/ L, em solução 10 Milimolar Tris-HCl (pH 7,5), 1 Milimolar EDTA. Frasco com 200 L (50 aplicações). No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** - Invitrogen..
Lote 20: MEDIDOR LABORATÓRIO. Marcador de massa de DNA. Fragmentos de ? DNA digeridos com HindIII. Marcador de DNA (125 bp ? 23,1 Kb), constituído por oito bandas padrão (**** bp, **** bp, **** bp, **** bp, **** bp, 2027 bp, 564 bp e 125 bp). Deve permitir a visualização de 7 a 8 bandas em gel de agarose (1 - 1,2%). Compatível com todos os tipos de agarose. Concentração: 0,5 ?g/mL, contida em solução 10 Milimolar Tris-HCl (pH 7,4), 5 Milimolar NaCl e 0,1 Milimolar EDTA. Frasco com 500 ?g/**** ?L (50 aplicações). No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote. Com padrão de qualidade igual ou superior ao **** - Invitrogen..
Lote 21: MEDIDOR LABORATÓRIO. Marcador de tamanho de DNA, 1 Kb, contendo um total de 20 bandas altamente purificadas, abrangendo de 100 bp a **** bp. Deve possuir: 12 (doze) bandas uniformemente espaçadas de 1 Kb a 12 Kb, em incrementos de **** bp; 01 (uma) banda de **** bp de rápida orientação, a qual contenha aproximadamente 8% da massa aplicada ao gel; 8 (oito) bandas variando de 100 a **** bp. Compatível com todos os tipos de agarose. Concentração: 1 ?g/?L, contida em solução 10 Milimolar Tris-HCl (pH 7,5), 50 Milimolar NaCl e 1 Milimolar EDTA. Frasco com **** ?g/**** ?L (500 aplicações). No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote. Com padrão de qualidade igual ou superior ao **** - Invitrogen..
Lote 22: MEDIDOR LABORATÓRIO. Óleo mineral, grau biologia molecular. Formulação líquida; incolor. Viscosidade (cSt) a 40ºC: 14,2 - 17,2; gravidade específica: 0,**** - 0,**** . Livre de DNAses, RNAses, NICKases e proteases. Frasco com 500 mL. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote. Com padrão de qualidade igual ou superior ao **** ? Sigma..
Lote 23: MEDIDOR LABORATÓRIO. Oligonucleotídeo (Primer) BOX, para aplicação em reação de PCR, em escala de síntese 200nMol, liofilizado, purificado por cartucho de fase reversa, de acordo com a sequência: 5´CTACGGCAAGGCGACGCTGACG3´. Rendimento mínimo a ser entregue maior ou igual 10 OD. Acompanhado de certificado de análise. Frasco. Acompanhado de folha de especificações que inclui: nome do oligonucleotídeo, sequência e tamanho, rendimento em ODs, nmole e ?g, temperatura de fusão (ºC), % GC, peso molecular, volume a ser adicionado de água para concentração de 50 pmol/ l. Com certificado de análise. No ato da entrega, deve restar ao menos 80% do período de validade do produto..
Lote 24: MEDIDOR LABORATÓRIO. Oligonucleotídeo (Primer) ERIC 1R, para aplicação em reação de PCR, em escala de síntese 200nMol, liofilizado, purificado por cartucho de fase reversa, de acordo com a sequência: 5´ATGTAAGCTCCTGGGGATTCAC3´. Rendimento mínimo a ser entregue maior ou igual 10 OD. Acompanhado de folha de especificações que inclui: nome do oligonucleotídeo, sequência e tamanho, rendimento em ODs, nmole e ?g, temperatura de fusão (ºC), % GC, peso molecular, volume a ser adicionado de água para concentração de 50 pmol/ l. Com certificado de análise. No ato da entrega, deve restar ao menos 80% do período de validade do produto..
Lote 25: MEDIDOR LABORATÓRIO. Oligonucleotídeo (Primer) ERIC 2, para aplicação em reação de PCR, em escala de síntese 200nMol, liofilizado, purificado por cartucho de fase reversa, de acordo com a sequência: 5´AAGTAAGTGACTGGGGTGAGCG3´. Rendimento mínimo a ser entregue maior ou igual 10 OD. Acompanhado de folha de especificações que inclui: nome do oligonucleotídeo, sequência e tamanho, rendimento em ODs, nmole e ?g, temperatura de fusão (ºC), % GC, peso molecular, volume a ser adicionado de água para concentração de 50 pmol/ l. Com certificado de análise. No ato da entrega, deve restar ao menos 80% do período de validade do produto..
Lote 26: MEDIDOR LABORATÓRIO. Oligonucleotídeo (Primer) REP 1R, para aplicação em reação de PCR, em escala de síntese 200nMol, liofilizado, purificado por cartucho de fase reversa, de acordo com a sequência: 5´IIIICGICGICATCIGGC3´. Rendimento mínimo a ser entregue maior ou igual 10 OD. Acompanhado de certificado de análise. Frasco. Acompanhado de folha de especificações que inclui: nome do oligonucleotídeo, sequência e tamanho, rendimento em ODs, nmole e ?g, temperatura de fusão (ºC), % GC, peso molecular, volume a ser adicionado de água para concentração de 50 pmol/ l. Com certificado de análise. No ato da entrega, deve restar ao menos 80% do período de validade do produto..
Lote 27: MEDIDOR LABORATÓRIO. Oligonucleotídeo (Primer) REP 2I, para aplicação em reação de PCR, em escala de síntese 200nMol, liofilizado, purificado por cartucho de fase reversa, de acordo com a sequência: 5´ICGICTTATCIGGCCTAC3´. Rendimento mínimo a ser entregue maior ou igual 10 OD. Acompanhado de certificado de análise. Frasco. Acompanhado de folha de especificações que inclui: nome do oligonucleotídeo, sequência e tamanho, rendimento em ODs, nmole e ?g, temperatura de fusão (ºC), % GC, peso molecular, volume a ser adicionado de água para concentração de 50 pmol/ l. Com certificado de análise. No ato da entrega, deve restar ao menos 80% do período de validade do produto..
Lote 28: MEDIDOR LABORATÓRIO. Solução de enzima Proteinase K de [Engyodontium álbum], protease serina não-específica. Grau biologia molecular, para digestão de proteínas. Ativa na presença de SDS ou uréia, agentes quelantes (p.ex., EDTA), em ampla gama de pH, concentração de sais e temperatura. Concentração: 20 mg/mL, em 10 Milimolar Tris-HCl, pH 7,5, Ca+2 e glicerol. Frasco 5 x 1,00 mL. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote. Com padrão de qualidade igual ou superior ao **** - Invitrogen.
Lote 29: MEDIDOR LABORATÓRIO. Proteinase K de [Tritirachium álbum], liofilizado. Grau biologia molecular, livre de DNAses, NICKases, e RNases. Proteína: maior ou igual 90 %. Concentração: maior ou igual 30 unidades/mg. Conteúdo de DNA menor ou igual a 500 pg/mg. Coloração branca ou esbranquiçada. Frasco com 100 mg No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** ? Sigma..
Lote 30: MEDIDOR LABORATÓRIO. Solução de enzima RNAse A (ribonuclease A, de pâncreas bovino), grau biologia molecular, para a purificação de DNA livre de RNA. Concentração 20 mg/mL em 50 Milimolar Tris-HCl, pH 8, 10 Milimolar EDTA; maior 70 unidades/mg. Frasco com 10 mL. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** Invitrogen.
Lote 31: MEDIDOR LABORATÓRIO. Tampão 10X PCR sem MgCl2. Tampão para reação de PCR, concentração 10X, sem adição de cloreto de magnésio (MgCl2). Formulação líquida, incolor. Grau biologia molecular, para uso em reação de PCR. Composição: 100 Milimolar Tris-HCl, pH 8,3 (25 ¨C), 500 Milimolar KCl. Livre de DNase, RNase, NICKase. Frasco com 1,5 mL. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** ? Sigma..
Lote 32: MEDIDOR LABORATÓRIO. Tampão TBE (Tris-Base-ácido bórico-EDTA) 10X. Solução TBE (Tris-Base-ácido bórico-EDTA), concentração 10X, filtrada e esterilizada. Composição: Tris-base 1 M; H3BO3 0,9 M; EDTA 0,01 M. Grau biologia molecular. Livre de DNase, RNase e protease. Usado para preparar tampão 1X para eletroforese de gel de agarose. Frasco com 1L. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** - Invitrogen..
Lote 33: MEDIDOR LABORATÓRIO. Tampão TE (Tris-HCl-EDTA) 1X. Solução Tris-HCl-EDTA (TE), concentração 1X. Composição: 10 Milimolar Tris-HCl (pH 8.0) e 1mM EDTA, Grau biologia molecular. Livre de DNase, RNase, fosfatase e protease. pH: 8,0 (25ºC). Al: menor ou igual a 1 mg/Kg; Ba: menor ou igual a 1 mg/Kg; Bi: menor ou igual a 1 mg/Kg; Ca: menor ou igual a 5 mg/Kg; Cd: menor ou igual a 1 mg/Kg; Co: menor ou igual a 1 mg/Kg; Cr: menor ou igual a 1 mg/Kg; Cu: menor ou igual a 1 mg/Kg; Fe: menor ou igual a 1 mg/Kg; K: menor ou igual a 20 mg/Kg; Li: menor ou igual a 1 mg/Kg; Mg: menor ou igual a 1 mg/Kg; Mn: menor ou igual a 1 mg/Kg; Mo: menor ou igual a 1 mg/Kg; Ni: menor ou igual a 1 mg/Kg; Pb: menor ou igual a 1 mg/Kg; Sr: menor ou igual a 1 mg/Kg; Zn: menor ou igual a 1 mg/Kg. Frasco com 100 mL No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** ? Fluka..
Lote 34: MEDIDOR LABORATÓRIO. Taq DNA Polimerase. Enzima termoestável Taq DNA Polimerase, de [Thermus aquaticus] recombinante, expresso em [Escherichia coli]. CAS nº. ****. Grau biologia molecular. Livre de endonucleases ou exonucleases contaminantes. Com atividade 5??3? polimerase e exonuclease. Para aplicação em reação PCR. Formulação líquida, incolor. Deve acompanhar tampão de reação 10X (100 Milimolar Tris-HCl, pH 8,3, 500 Milimolar KCl), e solução de MgCl2 25 Milimolar. Concentração: 5U/ L em 20 Milimolar Tris-HCl, pH 8,0, 100 Milimolar KCL, 0,1 Milimolar EDTA, 1 Milimolar DTT, estabilizadores e 50% glicerol. Conjunto com 1 x 250 U Taq, 1,5 mL de tampão de reação 10X e 1,5 mL de solução de MgCl2. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** ? Sigma..
Lote 35: MEDIDOR LABORATÓRIO. Taq DNA Polimerase acrescida da mistura de reação (master mix) para PCR. Solução pronta para uso contendo Taq DNA Polimerase, dNTPs (desoxirribonucleotídeos fosfatados: 400 M dATP, 400 M dGTP, 400 M dCTP, 400 M TTP), MgCl2 (3 Milimolar) e tampão de reação 2X (pH 8,5), em concentração ótima para amplificação eficiente de ampla gama de sequências de DNA. Grau biologia molecular. Livre de endonucleases ou exonucleases contaminantes. Enzima Taq com atividade 5??3? polimerase e exonuclease. Tampão de reação deve conter dois tampões de carregamento (azul e amarelo) para o monitoramento do processo durante eletroforese. Deve incluir frasco com água livre de nuclease. Conjunto com 1 x 25 mL de solução (cerca de **** reações) e 1 x 25 mL de água livre de nucleasse. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** ? Promega..
Lote 36: MEDIDOR LABORATÓRIO. Tris-Base. Tris (hidroximetil) aminometano. Fórmula química ****, peso molecular 121,14 grama/mol. CAS nº. ****. Pureza maior ou igual 99,8%. Grau biologia molecular. Livre de DNAse, RNAse, fosfatase e proteases. pH: 10,5 - 12,0 (25ºC, 4M em H2O). Perda em secagem: menor ou igual a 0,5% (110ºC). Cinzas: menor ou igual a 0,01%; Cl: menor ou igual a 20 mg/Kg; SO42: menor ou igual a 5 mg/Kg; Al: menor ou igual a 5 mg/Kg; As: menor ou igual a 0,1 mg/Kg; Ba: menor ou igual a 5 mg/Kg; Bi: menor ou igual a 5 mg/Kg; Ca: menor ou igual a 10 mg/Kg; Cd: menor ou igual a 5 mg/Kg; Co: menor ou igual a 5 mg/Kg; Cr: menor ou igual a 5 mg/Kg; Cu: menor ou igual a 5 mg/Kg; Fe: menor ou igual a 5 mg/Kg; K: menor ou igual a 50 mg/Kg; Li: menor ou igual a 5 mg/Kg; Mg: menor ou igual a 5 mg/Kg; Mn: menor ou igual a 5 mg/Kg; Mo: menor ou igual a 5 mg/Kg; Na: menor ou igual a 50 mg/Kg; Ni: menor ou igual a 5 mg/Kg; Pb: menor ou igual a 5 mg/Kg; Sr: menor ou igual a 5 mg/Kg; Zn: menor ou igual a 5 mg/Kg. Frasco com 500 g. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** - Sigma.
Lote 37: MEDIDOR LABORATÓRIO. Tris-HCl. Tris (hidroximetil) aminometano hidrocloreto. Fórmula química ****, peso molecular 157,60 grama/mol. CAS nº. ****. Pureza maior ou igual 99,0%. Grau biologia molecular. Livre de DNAses, RNAses, fosfatases e proteases. pH: 2,5 - 4,0 (25ºC, 4M em H2O). Perda em secagem: menor ou igual a 0,2% (110ºC). Cinzas: menor ou igual a 0,2%; SO42: menor ou igual a 50 mg/Kg; Al: menor ou igual a 5 mg/Kg; As: menor ou igual a 0,1 mg/Kg; Ba: menor ou igual a 5 mg/Kg; Bi: menor ou igual a 5 mg/Kg; Ca: menor ou igual a 10 mg/Kg; Cd: menor ou igual a 5 mg/Kg; Co: menor ou igual a 5 mg/Kg; Cr: menor ou igual a 5 mg/Kg; Cu: menor ou igual a 5 mg/Kg; Fe: menor ou igual a 5 mg/Kg; K: menor ou igual a 50 mg/Kg; Li: menor ou igual a 5 mg/Kg; Mg: menor ou igual a 5 mg/Kg; Mn: menor ou igual a 5 mg/Kg; Mo: menor ou igual a 5 mg/Kg; Na: menor ou igual a 50 mg/Kg; Ni: menor ou igual a 5 mg/Kg; Pb: menor ou igual a 5 mg/Kg; Sr: menor ou igual a 5 mg/Kg; Zn: menor ou igual a 5 mg/Kg. Frasco com 500 g. No ato da entrega, deve restar ao menos 80% do período de validade do produto. Deve vir acompanhado de certificado de análise do lote.Com padrão de qualidade igual ou superior ao **** - Sigma.

Assista ao Vídeo |

O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!

Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

Veja mais para Campinas |

1. Deleg. Secc. Policia De


1ª Delegacia Seccional De Policia De


2. Deleg. Secc. Policia De


2⪠Delegacia Seccional De Polícia De


2ª Delegacia Seccional De Polícia De


Camara Municipal De Campinas / (1) Camara Municipal De


Camara Municipal De Campinas / (1) Camara Municipal De


Camara Municipal De


Camara Municipal De


/ (1) Camara Municipal De Campinas

Centro De Deten. Prov. De


Centro Reg. Administracao De


Delegacia Seccional De Policia De


Diário Oficial Do Município De


(dom- Camp)

Dir. Reg. Assist. Des. Social De


Divisao Reg. Administracao De


Esc. Desenv. Rural De


Fundação Da Area De Saúde De


- Fascamp



- Caminho 333



- Sp-65

Licitações Públicas


- SP

Ministério Da Fazenda/ Secretaria Da Receita Federal/ Superintendências Regionais Da Receita Federal/ 8ª Região Fiscal/ Delegacia Da Receita Federal Em


Ministério Da Previdência Social/ Instituto Nacional Do Seguro Social/ Superintendência Estadual Em São Paulo/ Gerência Executiva


Municipio De Campinas / (1) Secretaria Municipal De Administracao
Municipio De Campinas / (1) Secretaria Municipal De Administracao
Municipio De


/ (1) Secretaria Municipal De Administracao

Prefeitura Municipal De


/ (1) Secretaria Municipal De Administracao

Prefeitura Municipal De


- Sp/

Prefeitura Municipal De


- Sp/ Antenor Chinaglia E Outros

Prefeitura Municipal De


- Sp/ Caixa Econômica Federal

Prefeitura Municipal De


- Sp/ Caixa Econômica Federal – Superintendência Regional Campinas (secretaria Municipal De Esportes E Lazer)

Prefeitura Municipal De


- Sp/ Cláudio Brandão E Outros

Prefeitura Municipal De


- Sp/ Comissão De Levantamento Dos Bens Patrimoniais

Prefeitura Municipal De


- Sp/ Conselho Gestor Da Area De Proteção Ambiental - Apa De Campinas (secretaria Municipal Do Verde, Meio Ambiente E Desenvolvimento Sustentavel)

Prefeitura Municipal De


- Sp/ Coord. Setorial De Transportes - Secretaria Municipal De Saúde

Prefeitura Municipal De


- Sp/ Diretoria De Convenios E Contratos

Prefeitura Municipal De


- Sp/ Diretoria De Convênios E Contratos (secretaria Munciipal De Esportes E Lazer)

Prefeitura Municipal De


- Sp/ Diretoria De Convênios E Contratos/ Sma

Prefeitura Municipal De


- Sp/ Diretoria De Convênios E Contratos/ Sma ( Secretaria Municipal De Infraestrutura)

Prefeitura Municipal De


- Sp/ Geraldo De Angelo

Prefeitura Municipal De


- Sp/ Josemar Pinheiro

Prefeitura Municipal De


- Sp/ Marcamp Equipamentos Ltda

Prefeitura Municipal De


- Sp/ Marcos Francisco Marchini

Prefeitura Municipal De


- Sp/ Prefeitura Municipal De Campinas

Prefeitura Municipal De


- Sp/ Royal Plan Plaza Participaçõese Empreendimentos Ltda

Prefeitura Municipal De


- Sp/ São Roque Administração De Bens Próprios Ltda.

Prefeitura Municipal De


- Sp/ Secretaria De Administração

Prefeitura Municipal De


- Sp/ Secretaria De Política Para As Mulheres (secretaria Municipal Dos Direitos Da Pessoa Com Deficiência E Mobilidade Reduzida)

Prefeitura Municipal De


- Sp/ Secretaria Muinicipal De Assistencia E Inclusão Social

Prefeitura Municipal De


- Sp/ Secretaria Muinicipal De Recursos Humanos

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Administração

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Administração(convenios E Contratos)

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Assistência Social E Segurança Alimentar

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Assuntos De Segurança Pública

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Assuntos Jurídicos

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Chefia De Gabinete Do Prefeito

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Cidadania, Assistencia E Inclusão Social

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Comunicação

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Cooperação Nos Assuntos De Segurança Pública

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Cooperação Nos Assuntos De Segurança Pública - 7° Grupamento De Bombeiros

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Cooperação Nos Assuntos De Segurança Pública – 7º Grupamento De Bombeiros

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Cooperação Nos Assuntos De Segurança Pública- 7° GB

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Cultura

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Desenvolvimento Econômico, Social E De Turismo

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Desenvolvimento Econônimo Social E De Turismo E Secretaria Municipal De Esportes E Lazer

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Educação

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Esporte E Lazer

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Esportes E Lazer

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Finanças

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Habitação

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Infraestrutura

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Infrestrutura

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Planejamento E Desenvolvimento Urbano

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Recursos Humanos

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Saúde

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Saúde - Objeto:

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Serviços Públicos

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Serviçospúblicos

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Trabalho E Renda

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Transportes

Prefeitura Municipal De


- Sp/ Secretaria Municipal De Turismo

Prefeitura Municipal De


- Sp/ Secretaria Municipal Do Verde, Meio Ambiente E Desenvolvimento Sustentável

Prefeitura Municipal De


- Sp/ Secretaria Municipal Do Verde, Meio Ambiente E Desenvolvimento Sustentável -

Procur. Regional De


Procuradoria Geral Do Estado Procur. Regional De


Procuradoria Geral Do Estado/ Procuradoria Geral Do Estado/ Procuradoria Regional De


Procuradoria Regional De


Sec. Segurança Pública/ Polícia Civil Do Estado De São Paulo/ 1ª Delegacia Seccional De Polícia De


Sec. Segurança Pública/ Polícia Civil Do Estado De Sao Paulo/ 2ª Delegacia Seccional De Polícia De


Secretaria Administracao Penitenciaria Centro De Deten. Prov. De


Secretaria Da Fazenda Centro Reg. Administracao De


Secretaria Da Seguranca Publica 1. Deleg. Secc. Policia De


Secretaria Da Seguranca Publica 2. Deleg. Secc. Policia De


SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
© 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.