Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599

(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |

Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |

O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Pregão Eletrônico Edital: 57/2016- Niterói Rj |

Atualizado em 29/09/2016. Acesse também licitações mais recentes e baixe os editais.



Lote 3: MEDIDOR LABORATÓRIO. Agar Base Micoplasma (Agar PPLO).
Lote 4: MEDIDOR LABORATÓRIO. Agar carvão cefoperaziona desoxicolato modificado Mccda Oxoid CM ****.
Lote 7: MEDIDOR LABORATÓRIO. Anexina V (Conjug Alexa Fluor 488) - 100 ensaios.
Lote 8: MEDIDOR LABORATÓRIO. Anticorpo anti-elastase humano feito em camundongo, clone AHN-10, 100 TESTES.
Lote 9: MEDIDOR LABORATÓRIO. Anticorpo secundário EnVision+/HRP, Dupla ligação Coelho/Camundongo, similar ou superior à marca DAKO.
Lote 12: MEDIDOR LABORATÓRIO. CellTrace - CFSE Kit Prol Celular (Citometria de Fluxo).
Lote 17: MEDIDOR LABORATÓRIO. Cultura liofilizada Bifidobacterium infantis para Culturas Probióticas em Produtos Lácteos.
Lote 18: MEDIDOR LABORATÓRIO. Cultura liofilizada Lactobacillus casei para Culturas Probióticas em Produtos Lácteos.
Lote 19: MEDIDOR LABORATÓRIO. Cultura liofilizada Streptococcus thermophilus para Culturas Probióticas em Produtos Lácteos.
Lote 20: MEDIDOR LABORATÓRIO. DAB líquido para uso manual, similar ou superior à marca DAKO.
Lote 29: MEDIDOR LABORATÓRIO. Entellan - meio de montagem água livre para a montagem permanente de espécimes para microscopia.
Lote 48: MEDIDOR LABORATÓRIO. Kit para sequenciamento Big Dye terminator cycle sequencing v3.1.
Lote 51: MEDIDOR LABORATÓRIO. Kit Qualitrol 1H - Preparação em matriz proteica humana liofilizada, para controle interno da qualidade em ensaios de química clínica - Para uso em equipamento automático Labmax 240 Premium - Validade minima de 12 meses a contar do mês de recebimento..
Lote 52: SOLUÇÃO LIMPEZA MULTIUSO. Kit Solução de limpeza Ácido: para equipamento automático Labmax 240 Premium - Validade minima de 12 meses a contar do mês de recebimento.
Lote 53: SOLUÇÃO LIMPEZA MULTIUSO. Kit Solução de limpeza Alcalina: para equipamento automático Labmax 240 Premium - Validade minima de 12 meses a contar do mês de recebimento..
Lote 55: MEDIDOR LABORATÓRIO. Lisine Iron Agar (LIA).
Lote 56: MEDIDOR LABORATÓRIO. Listeria caldo enriquecimento UVM.
Lote 57: MEDIDOR LABORATÓRIO. MagF 5´-CCTTTTAGATTGGGATAGCGGATG-3´ (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 58: MEDIDOR LABORATÓRIO. Marcador de Peso Molecular 100 bp - Unidade. Tampão de Armazenamento: 10 mM Tris-HCl (pH 8,0), 2 nM EDTA, Orange G e Glicerol.
Lote 59: MEDIDOR LABORATÓRIO. Marcador de Peso Molecular 50 bp - Unidade. Tampão de Armazenamento: 10 mM Tris-Hcl (pH 8,0), 10 mM EDTA. 6x Loading buffer LGC: 0,25% azul de bromofenol, 0,25% Xileno cianol FF, 15% Ficoll 400..
Lote 63: MEDIDOR LABORATÓRIO. MG B1: CGTGGATATCTTTAGTTCCAGCTGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 64: MEDIDOR LABORATÓRIO. MG B2: GTAGCAAGTTATAATTTCCAGGCAT (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 65: MEDIDOR LABORATÓRIO. MGF - f 5 TAACCCTTCATCACCTCATCTAGAG3 (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 66: MEDIDOR LABORATÓRIO. MGF- r 5 CTGTTTGCTAAAGAACAAGTTGATC3 (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 67: MEDIDOR LABORATÓRIO. MHP3 5 -AAGTTCATTCGCGCTAGCCC5´-3´ (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 68: MEDIDOR LABORATÓRIO. MHP4 5 -GCTCCTACTCCATAT TGCCC-3´ (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 69: MEDIDOR LABORATÓRIO. Monoclonal Anti-Humano IgG4 antibody produzido em camundongo (100 TESTES).
Lote 70: MEDIDOR LABORATÓRIO. Monoclonal anti-humano PLA2R1 anticorpo camundongo (100 TESTES).
Lote 71: MEDIDOR LABORATÓRIO. MS-f: GAGAAGCAAAATAGTGATATCA (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 72: MEDIDOR LABORATÓRIO. MsppF1 CGCCTGAGTAGTACGTTCGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 73: MEDIDOR LABORATÓRIO. MsppF2 CGCCTGAGTAGTACGTACGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 74: MEDIDOR LABORATÓRIO. MsppF3 TGCCTGAGTAGTACATTCGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 75: MEDIDOR LABORATÓRIO. MsppF4 TGCCTGGGTAGTACATTCGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 76: MEDIDOR LABORATÓRIO. MsppF5 CGCCTGGGTAGTACATTCGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 77: MEDIDOR LABORATÓRIO. MsppF6 CGCCTGAGTAGTATGCTCGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 78: MEDIDOR LABORATÓRIO. MsppR1 GCGGTGTGTACAAGACCCGA (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 79: MEDIDOR LABORATÓRIO. MsppR2 GCGGTGTGTACAAAACCCGA (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 80: MEDIDOR LABORATÓRIO. MsppR3 GCGGTGTGTACAAACCCCGA (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 81: MEDIDOR LABORATÓRIO. MS-r: C+C84AGTCGTCTCCGAAGTTAACAA (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 82: MEDIDOR LABORATÓRIO. Pares de primers ACC-1-F/ACC-1-R (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 83: MEDIDOR LABORATÓRIO. PCR-Mix - 100 Reações.
Lote 85: MEDIDOR LABORATÓRIO. PLACA PARA CROMATOGRAFIA DE CAMADA FINA (TLC) placa de plástico, coberta com fina camada de sílica revestida com indicador fluorescente; tamanho 500 x 20 cm..
Lote 86: MEDIDOR LABORATÓRIO. Plasma de coelho liofilizado - coaguplasma (5 x 3 mL).
Lote 87: MEDIDOR LABORATÓRIO. Polisensidisc (4 x 6) aranha de antimicrobianos.
Lote 88: MEDIDOR LABORATÓRIO. Primers em escala de 200 nmoles 24 bases para Micplasmas bovinos (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 89: MEDIDOR LABORATÓRIO. Qubit® dsDNA BR Assay Kit, 100 reações.
Lote 90: MEDIDOR LABORATÓRIO. Qubit® dsDNA HS Assay Kit, 100 reações.
Lote 97: MEDIDOR LABORATÓRIO. Soluble Receptor of Advanced Glycation End-Products (sRAGE). Human ELISA **** 96w.
Lote 98: MEDIDOR LABORATÓRIO. Solução antimicrobiana Campylofar.
Lote 99: MEDIDOR LABORATÓRIO. Soro anti Salmonella polivalente O.
Lote 100: MEDIDOR LABORATÓRIO. Soro eqüino para meio de cultura bacteriológico.
Lote 101: MEDIDOR LABORATÓRIO. Soro IgG de caprino (molécula inteira) conjugada de peroxidase.
Lote 102: MEDIDOR LABORATÓRIO. Soro IgY (IgG) de galinha (molécula inteira) conjugada de peroxidase.
Lote 104: MEDIDOR LABORATÓRIO. Suplemento ágar MOX SR 140.
Lote 105: MEDIDOR LABORATÓRIO. Suplemento para caldo Fraser SR 156E.
Lote 106: MEDIDOR LABORATÓRIO. Suplemento para Campylobacter-CAMPYLOFAR.
Lote 107: MEDIDOR LABORATÓRIO. Suplemento seletivo para PALCAM.
Lote 108: MEDIDOR LABORATÓRIO. Supplement for Listeria Enrichment Broth acc. to IDF-FIL ****.
Lote 110: MEDIDOR LABORATÓRIO. Taq DNA Polymerase (Recombinant), concentração: 5 U/µl, volume 500 unidades.
Lote 111: MEDIDOR LABORATÓRIO. Triple Sugar Iron Agar (TSI) 500g.
Lote 112: MEDIDOR LABORATÓRIO. Tripsina (Trypsin from porcine pancreas lyophilized powder, BioReagent, suitable for cell culture, 1,****,000 BAEE units/mg solid) - 50 mg.
Lote 113: MEDIDOR LABORATÓRIO. Coquetel inibidor de Protease.
Lote 114: MEDIDOR LABORATÓRIO. Padrão de peso molecular para proteína (BROAD RANGE PROTEIN MOLECULAR WEIGHT MARKERS) 5uL/Lane.
Lote 117: MEDIDOR LABORATÓRIO. Peptona de caseína.
Lote 118: MEDIDOR LABORATÓRIO. Caldo mossel.
Lote 122: MEDIDOR LABORATÓRIO. Reagente para isolamento de RNA - Trizol.

Assista ao Vídeo |

O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!

Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
Política de privacidade | © 2011-2018 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.