Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Pregão Eletrônico Edital: 57/2016- Niterói Rj |

Atualizado em 29/09/2016. Acesse também licitações mais recentes e baixe os editais.

29/09/2016 - RJ ( NITERÓI ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE FEDERAL FLUMINENSE/PRÓ-REITORIA DE PESQUISA, PÓS-GRADUAÇÃO E INOVAÇÃO (PROPPI) (UASG: 153248)

Aquisição de MATERIAL BIOLÓGICO e MEIOS DE CULTURA

Lote 1: MEDIDOR LABORATÓRIO. ÁCIDO DESCALCIFICANTE (CLORETO DE HIDROGÊNIO) ONU **** OU DESCALCIFICADOR DE ÓSSOS E MEDULAS.
Lote 2: ÁGAR. ÁGAR, TIPO ÁGAR BACTERIOLÓGICO, ASPECTO FÍSICO PÓ.
Lote 3: MEDIDOR LABORATÓRIO. Agar Base Micoplasma (Agar PPLO).
Lote 4: MEDIDOR LABORATÓRIO. Agar carvão cefoperaziona desoxicolato modificado Mccda Oxoid CM ****.
Lote 5: ÁGAR. ÁGAR, TIPO ÁGAR NOBRE, ASPECTO FÍSICO PÓ.
Lote 6: MEDIDOR LABORATÓRIO. ALEXA FLUOR 488 GOAT A.
Lote 7: MEDIDOR LABORATÓRIO. Anexina V (Conjug Alexa Fluor 488) - 100 ensaios.
Lote 8: MEDIDOR LABORATÓRIO. Anticorpo anti-elastase humano feito em camundongo, clone AHN-10, 100 TESTES.
Lote 9: MEDIDOR LABORATÓRIO. Anticorpo secundário EnVision+/HRP, Dupla ligação Coelho/Camundongo, similar ou superior à marca DAKO.
Lote 10: BÁLSAMO DO CANADÁ. BÁLSAMO DO CANADÁ, ORIGEM RESINA EXTRAÍDA DA MADEIRA, ASPECTO FÍSICO LÍQUIDO VISCOSO, COR AMARELO-CLARA, DENSIDADE 0,99 G/ML.
Lote 11: 99%, ADICIONAL LIVRE DE GLOBULINAS.
Lote 12: MEDIDOR LABORATÓRIO. CellTrace - CFSE Kit Prol Celular (Citometria de Fluxo).
Lote 13: MEIO DE CULTURA. MEIO DE CULTURA, TIPO MEIO CROMOGÊNICO PARA CANDIDA, APRESENTAÇÃO SÓLIDO, CARACTERÍSTICA ADICIONAL PLACA 90MM.
Lote 14: ENZIMA. ENZIMA, TIPO COLAGENASE, ASPECTO FÍSICO PÓ LIOFILIZADO, CARACTERÍSTICAS ADICIONAIS I-AS, DE CLOSTRIDIUM HISTOLYTICUM, CONCENTRAÇÃO MÍNIMO DE 125 U/MG.
Lote 15: CORANTE. CORANTE, TIPO CONJUNTO CORANTE HEMATOLÓGICO PANÓTICO RÁPIDO, ASPECTO FÍSICO LÍQUIDO, CARACTERÍSTICAS ADICIONAIS FRASCOS SEPARADOS CONTENDO, COMPOSIÇÃO 0,1% DE CICLOHEXADIENOS,0,1% DE AZOBENZOSULFÔNICO S, COMPONENTES ADICIONAIS 0,1% DE FENOTIAZINAS.
Lote 16: DEOXINUCLEOTÍDEO. DEOXINUCLEOTÍDEO, COMPOSIÇÃO ATP, GTP, TTP, CTP, CONCENTRAÇÃO 10 MILIMOLAR.
Lote 17: MEDIDOR LABORATÓRIO. Cultura liofilizada Bifidobacterium infantis para Culturas Probióticas em Produtos Lácteos.
Lote 18: MEDIDOR LABORATÓRIO. Cultura liofilizada Lactobacillus casei para Culturas Probióticas em Produtos Lácteos.
Lote 19: MEDIDOR LABORATÓRIO. Cultura liofilizada Streptococcus thermophilus para Culturas Probióticas em Produtos Lácteos.
Lote 20: MEDIDOR LABORATÓRIO. DAB líquido para uso manual, similar ou superior à marca DAKO.
Lote 21: ANTIBIOGRAMA. ANTIBIOGRAMA, PRINCÍPIO ATIVO CEFALOTINA, DOSAGEM 30 MCG.
Lote 22: ANTIBIOGRAMA.. ANTIBIOGRAMA., PRINCÍPIO ATIVO CEFTIOFUR, DOSAGEM 30 MCG.
Lote 23: ANTIBIOGRAMA. ANTIBIOGRAMA, PRINCÍPIO ATIVO ÁCIDO NALIDÍXICO, DOSAGEM 30 MCG.
Lote 24: ANTIBIOGRAMA. ANTIBIOGRAMA, PRINCÍPIO ATIVO AMOXICILINA E ÁCIDO CLAVULÂNICO, DOSAGEM 20 + 10MCG.
Lote 25: ANTIBIOGRAMA. ANTIBIOGRAMA, PRINCÍPIO ATIVO CIPROFLOXACINO, DOSAGEM 5 MCG.
Lote 26: ANTIBIOGRAMA. ANTIBIOGRAMA, PRINCÍPIO ATIVO CLORANFENICOL, CONCENTRAÇÃO 30 MCG.
Lote 27: ANTIBIOGRAMA. ANTIBIOGRAMA, PRINCÍPIO ATIVO TETRACICLINA, DOSAGEM 30 MCG.
Lote 28: DEOXINUCLEOTÍDEO. DEOXINUCLEOTÍDEO, COMPOSIÇÃO ATP, GTP, TTP, CTP, CONCENTRAÇÃO 25 MILIMOLAR PORFRASCO, CARACTERÍSTICAS ADICIONAIS COM 4 FRASCOS.
Lote 29: MEDIDOR LABORATÓRIO. Entellan - meio de montagem água livre para a montagem permanente de espécimes para microscopia.
Lote 30: ESFERA. ESFERAS DE CALIBRACAO DE 6 PICOS 2X4ML.
Lote 31: ESFERA. ESFERAS DE CALIBRACAO DE 8 PICOS 4ML.
Lote 32: CONJUNTO PARA ANÁLISE. CONJUNTO PARA ANÁLISE, APLICAÇÃO PARA PCR EM TEMPO REAL, COMPONENTES MISTURA PARA REAÇÃO, TAQ DNA POLIMERASE, UNG, CARACTERÍSTICAS ADICIONAIS DNTPS, SOLUÇÕES TAMPÃO, 2X, OUTROS COMPONENTES CORANTE CIANINA, CORANTE PARA CONTROLEINTERNO.
Lote 33: CORANTE. CORANTE, TIPO INDICADOR FLUORESCENTE, APLICAÇÃO PARA ÁCIDOS NUCLEICOS EM GEL, CARACTERÍSTICAS ADICIONAIS EXCITAÇÃO/ EMISSÃO- 290,380,497 NM/ 520 NM, CONCENTRAÇÃO ****.
Lote 34: CORANTE. CORANTE, TIPO CONJUNTO COLORAÇÃO ÁCIDO PERIÓDICO/ SCHIFF, ASPECTO FÍSICO LÍQUIDO, COMPOSIÇÃO SOLUÇÃO ÁCIDO PERIÓDICO, REAGENTE SCHIFF, COMPONENTES ADICIONAIS HEMATOXILINA.
Lote 35: REAGENTE PARA DIAGNÓSTICO CLÍNICO. REAGENTE PARA DIAGNÓSTICO CLÍNICO, TIPO CONJUNTO COMPLETO PARA AUTOMAÇÃO, TIPODE ANÁLISE QUANTITATIVO DE ALBUMINA, MÉTODO COLORIMÉTRICO DE PONTO FINAL, APRESENTAÇÃO TESTE.
Lote 36: CORANTE. CORANTE, TIPO AZUL ALCIAN, ASPECTO FÍSICO PÓ, CARACTERÍSTICAS ADICIONAIS CI ****.
Lote 37: REAGENTE PARA DIAGNÓSTICO CLÍNICO.. REAGENTE PARA DIAGNÓSTICO CLÍNICO., TIPO CONJUNTO COMPLETO PARA AUTOMAÇÃO, TIPO DE ANÁLISE QUANTITATIVO DE AST/TGO, MÉTODO CINÉTICO UV, APRESENTAÇÃO TESTE.
Lote 38: REAGENTE PARA DIAGNÓSTICO CLÍNICO¨. REAGENTE PARA DIAGNÓSTICO CLÍNICO¨, TIPO PARA AUTOMAÇÃO EM BIOQUÍMICA, TIPO DEANÁLISE CALIBRADOR MULTIPARAMÉTRICO, APRESENTAÇÃO LIOFILIZADO, CARACTERÍSTICA ADICIONAL MÍNIMO DE 25 ANALITOS.
Lote 39: REAGENTE PARA DIAGNÓSTICO CLÍNICO¨. REAGENTE PARA DIAGNÓSTICO CLÍNICO¨, TIPO CONJUNTO COMPLETO PARA AUTOMAÇÃO, TIPO DE ANÁLISE QUANTITATIVO PARA GASOMETRIA, APRESENTAÇÃO TESTE, COMPOSIÇÃO BÁSICA PH, PCO2, PO2, NA+, K+, CA++, CL-, OUTROS COMPONENTES HCT, THB, SATURAÇÃO DE 02, COMPONENTES ADICIONAIS CREATININA, BILIRRUBINA, LACTATO.
Lote 40: CONJUNTO PARA ANÁLISE. CONJUNTO PARA ANÁLISE, APLICAÇÃO EXTRAÇÃO DNA GENÔMICO SANGUE, TECIDOS, BACTÉRIAS, COMPONENTES SOLUÇÕES LISE, SOLUÇÕES TAMPÃO, RNASE A, COMPONENTES ADICIONAIS PROTEINASE K, TUBOS DE CENTRIFUGAÇÃO E COLETA.
Lote 41: CONJUNTO PARA ANÁLISE. CONJUNTO PARA ANÁLISE, APLICAÇÃO EXTRAÇÃO DNA GENÔMICO SANGUE, TECIDOS, BACTÉRIAS, COMPONENTES SOLUÇÕES LISE, SOLUÇÕES TAMPÃO, RNASE A, COMPONENTES ADICIONAIS PROTEINASE K, TUBOS DE CENTRIFUGAÇÃO E COLETA.
Lote 42: CONJUNTO PARA ANÁLISE. CONJUNTO PARA ANÁLISE, APLICAÇÃO EXTRAÇÃO PURIFICAÇÃO DE DNA SANGUE TOTAL E FRAÇÕE S, COMPONENTES PROTEINASE K, SOLUÇÃO DE LISE, SOLUÇÃO DE LAVAGEM, OUTROS COMPONENTES TAMPÃO DE ELUIÇÃO, COLUNAS, TUBOS DE COLETA.
Lote 43: MEDIDOR LABORATÓRIO. KIT DE FLUIDOS P/ ACCURI C6.
Lote 44: CORANTE. CORANTE, TIPO CONJUNTO COLORAÇÃO TRICRÔMIO DE MASSON, COMPOSIÇÃO HEMATOXILINA WEIGERT, ÁCIDO PÍCRICO, COMPONENTES ADICIONAIS FUCSINA MALLORY, AZUL ANILINA MASSON.
Lote 45: REAGENTE PARA DIAGNÓSTICO CLÍNICO. REAGENTE PARA DIAGNÓSTICO CLÍNICO, TIPO CONJUNTO COMPLETO PARA AUTOMAÇÃO, TIPODE ANÁLISE QUANTITATIVO DE FOSFATASE ALCALINA, MÉTODO CINÉTICO FOTOMÉTRICO, APRESENTAÇÃO TESTE.
Lote 46: REAGENTE PARA DIAGNÓSTICO CLÍNICO. REAGENTE PARA DIAGNÓSTICO CLÍNICO, TIPO CONJUNTO COMPLETO PARA AUTOMAÇÃO, TIPODE ANÁLISE QUANTITATIVO DE GAMA GLUTAMIL TRANSFERASE, MÉTODO CINÉTICO COLORIMÉTRICO DE PONTO FINAL, APRESENTAÇÃO TESTE.
Lote 47: CORANTE. CORANTE, TIPO CONJUNTO COLORAÇÃO GROCOTT, ASPECTO FÍSICO LÍQUIDO, COMPOSIÇÃO SOLUÇÕES ÁCIDAS, SALINAS E CORANTES.
Lote 48: MEDIDOR LABORATÓRIO. Kit para sequenciamento Big Dye terminator cycle sequencing v3.1.
Lote 49: REAGENTE PARA DIAGNÓSTICO CLÍNICO÷. REAGENTE PARA DIAGNÓSTICO CLÍNICO÷, TIPO PLASMA CONTROLE, TIPO DE ANÁLISE TEMPO DE PROTROMBINA E TTPA, APRESENTAÇÃO LIOFILIZADO, COMPOSIÇÃO BÁSICA PARA TESTES COAGULAÇÃO NA TERAPIA ANTICOAGULANTE, CARACTERÍSTICAS ADICIONAIS CONTROLE MÉDIO.
Lote 50: REAGENTE PARA DIAGNÓSTICO CLÍNICO*. REAGENTE PARA DIAGNÓSTICO CLÍNICO*, TIPO CONJUNTO COMPLETO PARA AUTOMAÇÃO, TIPO DE ANÁLISE QUANTITATIVO DE PROTEÍNAS TOTAIS, MÉTODO COLORIMÉTRICO DE PONTO FINAL, APRESENTAÇÃO TESTE.
Lote 51: MEDIDOR LABORATÓRIO. Kit Qualitrol 1H - Preparação em matriz proteica humana liofilizada, para controle interno da qualidade em ensaios de química clínica - Para uso em equipamento automático Labmax 240 Premium - Validade minima de 12 meses a contar do mês de recebimento..
Lote 52: SOLUÇÃO LIMPEZA MULTIUSO. Kit Solução de limpeza Ácido: para equipamento automático Labmax 240 Premium - Validade minima de 12 meses a contar do mês de recebimento.
Lote 53: SOLUÇÃO LIMPEZA MULTIUSO. Kit Solução de limpeza Alcalina: para equipamento automático Labmax 240 Premium - Validade minima de 12 meses a contar do mês de recebimento..
Lote 54: REAGENTE PARA DIAGNÓSTICO CLÍNICO.. REAGENTE PARA DIAGNÓSTICO CLÍNICO., TIPO CONJUNTO COMPLETO PARA AUTOMAÇÃO, TIPO DE ANÁLISE QUANTITATIVO DE URÉIA, MÉTODO CINÉTICO UV, APRESENTAÇÃO TESTE.
Lote 55: MEDIDOR LABORATÓRIO. Lisine Iron Agar (LIA).
Lote 56: MEDIDOR LABORATÓRIO. Listeria caldo enriquecimento UVM.
Lote 57: MEDIDOR LABORATÓRIO. MagF 5´-CCTTTTAGATTGGGATAGCGGATG-3´ (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 58: MEDIDOR LABORATÓRIO. Marcador de Peso Molecular 100 bp - Unidade. Tampão de Armazenamento: 10 mM Tris-HCl (pH 8,0), 2 nM EDTA, Orange G e Glicerol.
Lote 59: MEDIDOR LABORATÓRIO. Marcador de Peso Molecular 50 bp - Unidade. Tampão de Armazenamento: 10 mM Tris-Hcl (pH 8,0), 10 mM EDTA. 6x Loading buffer LGC: 0,25% azul de bromofenol, 0,25% Xileno cianol FF, 15% Ficoll 400..
Lote 60: MEIO DE CULTURA. MEIO DE CULTURA, TIPO MRS CALDO, APRESENTAÇÃO PÓ.
Lote 61: MEDIDOR LABORATÓRIO. MEMBRANA ISOPORE EM POLICARBONATO, 0,2UM DE PORO, 25MM DE DIAMETRO, PRETA, LISA.
Lote 62: MEDIDOR LABORATÓRIO. MEMBRANA ISOPORE EM POLICARBONATO, 0,2UM DE PORO, 25MM DE DIAMETRO, PRETA, LISA.
Lote 63: MEDIDOR LABORATÓRIO. MG B1: CGTGGATATCTTTAGTTCCAGCTGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 64: MEDIDOR LABORATÓRIO. MG B2: GTAGCAAGTTATAATTTCCAGGCAT (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 65: MEDIDOR LABORATÓRIO. MGF - f 5 TAACCCTTCATCACCTCATCTAGAG3 (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 66: MEDIDOR LABORATÓRIO. MGF- r 5 CTGTTTGCTAAAGAACAAGTTGATC3 (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 67: MEDIDOR LABORATÓRIO. MHP3 5 -AAGTTCATTCGCGCTAGCCC5´-3´ (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 68: MEDIDOR LABORATÓRIO. MHP4 5 -GCTCCTACTCCATAT TGCCC-3´ (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 69: MEDIDOR LABORATÓRIO. Monoclonal Anti-Humano IgG4 antibody produzido em camundongo (100 TESTES).
Lote 70: MEDIDOR LABORATÓRIO. Monoclonal anti-humano PLA2R1 anticorpo camundongo (100 TESTES).
Lote 71: MEDIDOR LABORATÓRIO. MS-f: GAGAAGCAAAATAGTGATATCA (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 72: MEDIDOR LABORATÓRIO. MsppF1 CGCCTGAGTAGTACGTTCGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 73: MEDIDOR LABORATÓRIO. MsppF2 CGCCTGAGTAGTACGTACGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 74: MEDIDOR LABORATÓRIO. MsppF3 TGCCTGAGTAGTACATTCGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 75: MEDIDOR LABORATÓRIO. MsppF4 TGCCTGGGTAGTACATTCGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 76: MEDIDOR LABORATÓRIO. MsppF5 CGCCTGGGTAGTACATTCGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 77: MEDIDOR LABORATÓRIO. MsppF6 CGCCTGAGTAGTATGCTCGC (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 78: MEDIDOR LABORATÓRIO. MsppR1 GCGGTGTGTACAAGACCCGA (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 79: MEDIDOR LABORATÓRIO. MsppR2 GCGGTGTGTACAAAACCCGA (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 80: MEDIDOR LABORATÓRIO. MsppR3 GCGGTGTGTACAAACCCCGA (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 81: MEDIDOR LABORATÓRIO. MS-r: C+C84AGTCGTCTCCGAAGTTAACAA (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 82: MEDIDOR LABORATÓRIO. Pares de primers ACC-1-F/ACC-1-R (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 83: MEDIDOR LABORATÓRIO. PCR-Mix - 100 Reações.
Lote 84: MEDIDOR LABORATÓRIO. PENICILINA/ESTREPTOMICINA/GLUTAMINA - 100 ML.
Lote 85: MEDIDOR LABORATÓRIO. PLACA PARA CROMATOGRAFIA DE CAMADA FINA (TLC) placa de plástico, coberta com fina camada de sílica revestida com indicador fluorescente; tamanho 500 x 20 cm..
Lote 86: MEDIDOR LABORATÓRIO. Plasma de coelho liofilizado - coaguplasma (5 x 3 mL).
Lote 87: MEDIDOR LABORATÓRIO. Polisensidisc (4 x 6) aranha de antimicrobianos.
Lote 88: MEDIDOR LABORATÓRIO. Primers em escala de 200 nmoles 24 bases para Micplasmas bovinos (Para PCR e eletroforese -Primers em escala de 200 nm).
Lote 89: MEDIDOR LABORATÓRIO. Qubit® dsDNA BR Assay Kit, 100 reações.
Lote 90: MEDIDOR LABORATÓRIO. Qubit® dsDNA HS Assay Kit, 100 reações.
Lote 91: REAGENTE PARA DIAGNÓSTICO CLÍNICO*. REAGENTE PARA DIAGNÓSTICO CLÍNICO*, TIPO CONJUNTO COMPLETO, CARACTERÍSTICAS ADICIONAIS P/ CONTADOR DE CÉLULAS, COMPONENTES ADICIONAIS SOLUÇÕES PADRÃO.
Lote 92: REAGENTE PARA DIAGNÓSTICO CLÍNICO*. REAGENTE PARA DIAGNÓSTICO CLÍNICO*, CARACTERÍSTICAS ADICIONAIS PARA EQUIPAMENTO HEMATOLOGIA- HEMOGRAMA, COMPONENTES ADICIONAIS SOLUÇÃO DILUENTE.
Lote 93: SUPLEMENTO PARA MEIO DE CULTURA. SUPLEMENTO PARA MEIO DE CULTURA, TIPO MISTURA DE SAIS BILIARES, ASPECTO FÍSICOPÓ.
Lote 94: SUPLEMENTO PARA MEIO DE CULTURA. SUPLEMENTO PARA MEIO DE CULTURA, TIPO SANGUE DE CARNEIRO DESFIBRINADO, ASPECTOFÍSICO LÍQUIDO, CARACTERÍSTICAS ADICIONAIS ESTÉRIL.
Lote 95: SUPLEMENTO PARA MEIO DE CULTURA. SUPLEMENTO PARA MEIO DE CULTURA, TIPO SANGUE DE CAVALO DESFIBRINADO, ASPECTO FÍSICO LÍQUIDO, CARACTERÍSTICAS ADICIONAIS ESTÉRIL.
Lote 96: SUPLEMENTO PARA MEIO DE CULTURA. SUPLEMENTO PARA MEIO DE CULTURA, TIPO SORO FETAL BOVINO, ASPECTO FÍSICO LÍQUIDO.
Lote 97: MEDIDOR LABORATÓRIO. Soluble Receptor of Advanced Glycation End-Products (sRAGE). Human ELISA **** 96w.
Lote 98: MEDIDOR LABORATÓRIO. Solução antimicrobiana Campylofar.
Lote 99: MEDIDOR LABORATÓRIO. Soro anti Salmonella polivalente O.
Lote 100: MEDIDOR LABORATÓRIO. Soro eqüino para meio de cultura bacteriológico.
Lote 101: MEDIDOR LABORATÓRIO. Soro IgG de caprino (molécula inteira) conjugada de peroxidase.
Lote 102: MEDIDOR LABORATÓRIO. Soro IgY (IgG) de galinha (molécula inteira) conjugada de peroxidase.
Lote 103: MEDIDOR LABORATÓRIO. STREPTAVIDIN HRP, 1 mL.
Lote 104: MEDIDOR LABORATÓRIO. Suplemento ágar MOX SR 140.
Lote 105: MEDIDOR LABORATÓRIO. Suplemento para caldo Fraser SR 156E.
Lote 106: MEDIDOR LABORATÓRIO. Suplemento para Campylobacter-CAMPYLOFAR.
Lote 107: MEDIDOR LABORATÓRIO. Suplemento seletivo para PALCAM.
Lote 108: MEDIDOR LABORATÓRIO. Supplement for Listeria Enrichment Broth acc. to IDF-FIL ****.
Lote 109: MEDIDOR LABORATÓRIO. SYBR SAFE DNA GEL STAIN.
Lote 110: MEDIDOR LABORATÓRIO. Taq DNA Polymerase (Recombinant), concentração: 5 U/µl, volume 500 unidades.
Lote 111: MEDIDOR LABORATÓRIO. Triple Sugar Iron Agar (TSI) 500g.
Lote 112: MEDIDOR LABORATÓRIO. Tripsina (Trypsin from porcine pancreas lyophilized powder, BioReagent, suitable for cell culture, 1,****,000 BAEE units/mg solid) - 50 mg.
Lote 113: MEDIDOR LABORATÓRIO. Coquetel inibidor de Protease.
Lote 114: MEDIDOR LABORATÓRIO. Padrão de peso molecular para proteína (BROAD RANGE PROTEIN MOLECULAR WEIGHT MARKERS) 5uL/Lane.
Lote 115: MEDIDOR LABORATÓRIO. HEPES - REFERENCIA LGC BIOTECNOLOGIA.
Lote 116: TRIS(HIDROXIMETIL)AMINOMETANO. TRIS(HIDROXIMETIL)AMINOMETANO, COMPOSIÇÃO QUÍMICA ****, ASPECTO FÍSICO PÓ BRANCO CRISTALINO, PESO MOLECULAR 121,14 G/MOL, PUREZA PUREZA MÍNIMA DE 99,8%,CARACTERÍSTICAS ADICIONAIS ISENTO DNASE/RNASE, REAGENTE P/ BIOLOGIA MOLECULA R, NÚMERO DE REFERÊNCIA QUÍMICA CAS ****.
Lote 117: MEDIDOR LABORATÓRIO. Peptona de caseína.
Lote 118: MEDIDOR LABORATÓRIO. Caldo mossel.
Lote 119: ANTIBIOGRAMA.. ANTIBIOGRAMA., PRINCÍPIO ATIVO ENROFLOXACINO, DOSAGEM 5 MCG.
Lote 120: ANTIBIOGRAMA. ANTIBIOGRAMA, PRINCÍPIO ATIVO GENTAMICINA, DOSAGEM 10 MCG.
Lote 121: AGAROSE. AGAROSE, ASPECTO FÍSICO GEL, TIPO DE BAIXO PONTO DE FUSÃO, CARACTERÍSTICAS ADICIONAIS ESTÉRIL, CONCENTRAÇÃO 4%.
Lote 122: MEDIDOR LABORATÓRIO. Reagente para isolamento de RNA - Trizol.
Lote 123: MEIO DE CULTURA. MEIO DE CULTURA, TIPO ÁGAR MUELLER HINTON, APRESENTAÇÃO PÓ.
Lote 124: MEIO DE CULTURA. MEIO DE CULTURA, TIPO CALDO MUELLER HINTON, APRESENTAÇÃO PÓ.

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
Política de privacidade | © 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.