Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Pregão Eletrônico Edital: 89/2016- Belém Pa |

Atualizado em 10/08/2016. Acesse também licitações mais recentes e baixe os editais.

10/08/2016 - PA ( BELÉM ): GOVERNO DO ESTADO DO PARÁ/SECRETARIA ESPECIAL DE ESTADO DE PROMOÇÃO SOCIAL/SECRETARIA EXECUTIVA DE SAÚDE PÚBLICA/HOSPITAL OPHIR LOYOLA (UASG: 925450)

Aquisição de Material técnico para Laboratório de Biologia Molecular

Lote 1: MATERIAL DE SOBREVIVENCIA. Ensaio para expressão gênica tipo Taqman ou equivalente, inventoriado, do gene fusionado BCR-ABL que englobe três ou mais pontos de quebra distintos com dois ou mais marcadores, capaz de realizar no mínimo 250 reações..
Lote 2: MATERIAL DE SOBREVIVENCIA. Master Mix para realização de PCR em tempo real do tipo Taqman ou equivalente Universal, que utilize o método de detecção por meio de primer e sonda compatível com a leitura pelo equipamento ****.
Lote 3: MATERIAL DE SOBREVIVENCIA. Primer flanqueador para amplificação do material genético na região B2A2 do gene fusionado BCR-ABL, customizados com as sequências AGCATTCCGCTGACCATCAATAA (Forward) utilizando sonda do tipo FAM com anelamento na sequência CTGAAGGGCTTCTTCC..
Lote 4: MATERIAL DE SOBREVIVENCIA. Kit de PCR em tempo real sensível com resposta molecular de até 4.5 (RM4.5) e multiplexado com o gene BCR-ABL e ABL, com utilização prevista para monitorar os níveis de genes de fusão BCR-ABL de pacientes com Leucemia Mielóide Crônica (LMC). O ensaio é iniciado com RNA como entrada para a reação de transcrição reversa (RT) a fim de gerar o cDNA, e a partir dele é feito o PCR quantitativo. Todos os reagentes necessários estão presentes no kit. Capaz de realizar pelo menos 40 reações.
Lote 5: MATERIAL DE SOBREVIVENCIA. Primer flanqueador para amplificação do material genético na região B2A2 do gene fusionado BCR-ABL, customizados com as sequências AGGCTCAAAGTCAGATGCTACTG (reverse), sonda do tipo FAM com anelamento na sequência CTGAAGGGCTTCTTCC..
Lote 6: MATERIAL DE SOBREVIVENCIA. Primer flanqueador para amplificação do material genético na região B3A2 do gene fusionado BCR-ABL, customizados com as sequências GTTTCTGAATGTCATCGTCCACTCA (Forward), utilizando sonda do tipo FAM com anelamento na sequência CAGAGTTCAAAAGCCC..
Lote 7: MATERIAL DE SOBREVIVENCIA. Primer flanqueador para amplificação do material genético na região B3A2 do gene fusionado BCR-ABL, customizados com as sequências GATGCTACTGGCCGCTGAA (reverse), utilizando sonda do tipo FAM com anelamento na sequência CAGAGTTCAAAAGCCC..
Lote 8: MATERIAL DE SOBREVIVENCIA. Primer flanqueador para amplificação do material genético na região A2-3A3 do gene fusionado BCR-ABL, customizados com as sequências TTGTGGCCAGTGGAGATAACAC (Forward), utilizando sonda do tipo FAM com anelamento na sequência CCGGAGCTTTTCACCTTT..
Lote 9: MATERIAL DE SOBREVIVENCIA. Primer flanqueador para amplificação do material genético na região A2-3A3 do gene fusionado BCR-ABL, customizados com as sequências GCTTCACACCATTCCCCATTG (reverse), utilizando sonda do tipo FAM com anelamento na sequência CCGGAGCTTTTCACCTTT..
Lote 10: MATERIAL DE SOBREVIVENCIA. Trizol reagente próprio para isolamento do RNA total de células e tecidos; solução monofásica de fenol e isotiocinato de guanidina. Frasco de 100 mL.
Lote 11: MATERIAL DE SOBREVIVENCIA. Conjunto de reagentes necessários para conversão quantitativa para a conversão de RNA em cDNA por meio da técnica de Transcrição Reversa de Alta Qualidade, suficiente para no mínimo **** (um mil) reações..
Lote 12: MATERIAL DE SOBREVIVENCIA. Histopaque, solução contendo polissacarose e diatrizoato de sódio, com densidade de 1,077 g/mL, utilizado para facilitar a separação rápida de linfócitos e outras células mononucleadas viáveis. Volume: 500 mL.
Lote 13: MATERIAL DE SOBREVIVENCIA. Hidróxido de Sódio, fórmula química NaOH, na concentração de 10 molar em água, para uso em biologia molecular, livre de DNase e RNase. Volume de 100 mL.
Lote 14: MATERIAL DE SOBREVIVENCIA. Tampão fosfato salino 10x concentrado, volume de **** mL.
Lote 15: MATERIAL DE SOBREVIVENCIA. Cloreto de amonio.
Lote 16: MATERIAL DE SOBREVIVENCIA. Solução estabilizante de EDTA sla sódico, anticoagulante universal, pH de 6,6 a 6,8, volume 500 mL.
Lote 17: MATERIAL DE SOBREVIVENCIA. Bicarbonato de potássio (KHCO3), densidade de 2,17g/cm , massa molar de 100,115 g/mol, 1 kg.

Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

Veja mais para Belém |


Licitações

Belém

- 2º Bloco-prédio Anexo Ao Detran

Licitações

Belém

- AL

Licitações Públicas

Belém

- Bairr0-marco

Licitações Públicas

Belém

- PA

Ministério Da Defesa/ Comando Da Aeronáutica/ Comando- Geral De Operações Aéreas/ Primeiro Comando Aéreo Regional - I Comar/ Base Aérea De

Belém


Ministério Da Defesa/ Comando Do Exército/ Comando Militar Da Amazônia/ 8ª Região Militar/ Hospital Geral De

Belém


Ministério Da Fazenda/ Secretaria Da Receita Federal/ Superintendências Regionais Da Receita Federal/ 2ª Região Fiscal/ Delegacia Da Receita Federal De Julgamento Em

Belém


Ministério Da Fazenda/ Secretaria Da Receita Federal/ Superintendências Regionais Da Receita Federal/ 2ª Região Fiscal/ Delegacia Da Receita Federal Em

Belém


Ministério Da Fazenda/ Serviço Federal De Processamento De Dados (serpro)/ Regional

Belém


Ministério Da Previdência Social/ Instituto Nacional Do Seguro Social/ Gerência Executiva

Belém


Prefeitura Municipal De

Belém


Prefeitura Municipal De

Belém

- Pa - Fmae

Prefeitura Municipal De

Belém

- Pa - Gmb

Prefeitura Municipal De

Belém

- Pa - Ipamb

Prefeitura Municipal De

Belém

- Pa - Promaben

Prefeitura Municipal De

Belém

- Pa - Segep

Prefeitura Municipal De

Belém

- Pa - Semec

Prefeitura Municipal De

Belém

- Pa - Semob

Prefeitura Municipal De

Belém

- Pa - Sesma

Prefeitura Municipal De

Belém

/ Comissão Permanente De Licitação

Prefeitura Municipal De

Belém

/ Instituto De Previdencia E Assistencia Do Municipio De Belem/ Para

Prefeitura Municipal De

Belém

/ Secretaria Municipal De Educação


SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
Política de privacidade | © 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.