Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599

(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |

Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |

O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Idt |

Atualizado em 22/02/2017. Acesse também licitações mais recentes e baixe os editais.


Registro de Preços para futura e eventual contratação de pessoa jurídica para aquisição de gêneros alimentícios, visando atender às necessidades do IDT, conforme condições especificadas no Termo de Referência – Anexo I.

Lote 1: Registro de Preços para futura e eventual contratação de pessoa jurídica para aquisição de gêneros alimentícios, visando atender às necessidades do IDT, nos municípios onde estão sendo executadas as aulas do PROJOVEM Campo, Edição 2014, conforme condições especificadas no Termo de Referência  Anexo I. LOTE 01 - Municípios atendidos (ZONA RURAL): PINDORETAMA, CASCAVEL, FORTIM, ARACATI, ICAPUÍ, JAGUARUANA, MAURITI, QUIXERAMOBIM, GUAIUBA totalizando 600 alunos:
Lote 2: Registro de Preços para futura e eventual contratação de pessoa jurídica para aquisição de gêneros alimentícios, visando atender às necessidades do Instituto de Desenvolvimento do Trabalho  IDT, nos municípios onde estão sendo executadas as aulas do PROJOVEM Campo, Edição 2014, conforme especificações constantes no Termo de Referência-Anexo I. LOTE 02 Municípios atendidos (ZONA RURAL):CAUCAIA, SAO LUIS DO CURU, TIANGUÁ, PIRES FERREIRA, ARARENDÁ, IPUEIRAS, CRATEÚS e ARARIPE totalizando 600 alunos:

26/12/2016 - CE: IDT /(2) FORTALEZA

Registro de Preços para aquisição de Material dos Kit’s Trabalhador, para atender às necessidades do Instituto de Desenvolvimento do Trabalho – IDT, conforme especificações do Termo de Referência – Anexo I.


Aquisição de insumos de uso laboratorial, tais como: high sensitivity, oligonucleotídeos, testes, kits Elisa, etc.

Lote 3: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Ascaris spp. F, 1 mole Purificação: Standard Desalting Sequência F- 5 GTAATAGCAGTCGGCGGTTTCTT 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação (Item 01 SAPAR 028/2016).
Lote 4: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Ascaris spp. R, 1 mole Purificação: Standard Desalting Sequência R- 5 GCCCAACATGCCACCTATTC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação. (Item 02 SAPAR 028/2016).
Lote 5: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Trichuris trichuria F, 1 mole Purificação: Standard Desalting Sequência F- 5 TCCGAACGGCGGATCA 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação. (Item 03 SAPAR 028/2016).
Lote 6: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Trichuris trichuria R, 1 mole Purificação: Standard Desalting Sequência R - 5 CTCGAGTGTCACGTCGTCCTT 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação. (Item 04 SAPAR 028/2016).
Lote 7: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Strongyloides F, 1 mole Purificação: Standard Desalting Sequência F- 5 GGGCCGGACACTATAAGGAT 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação. (Item 05 SAPAR 028/2016).
Lote 8: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Strongyloides R, 1 mole Purificação: Standard Desalting Sequência R - 5 TGCCTCTGGATATTGCTCAGTTC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação. (Item 06 SAPAR 028/2016).
Lote 9: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, S. mansoni F, 1 mole Purificação: Standard Desalting Sequência F: CCGACCAACCGTTCTATGA, ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 01 SAPAR 029/2016).
Lote 10: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, S. mansoni R, 1 mole Purificação: Standard Desalting Sequência R: CACGCTCTCGCAAATAATCTAAA, ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 02 SAPAR 029/2016).
Lote 11: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, Probe S. mansoni P01, 1 mole Purificação: HPLC Purification Sequência P01: 56-FAMN/TCGTTGTATCTCCGAAACCACTGGACG/3BHQ, ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 03 SAPAR 029/2016).
Lote 12: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, H. sapiens ACTB F, 1 mole Purificação: Standard Desalting Sequência ACTB F: 5 CCATCTACGAGGGGTATGC 3 ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 04 SAPAR 029/2016).
Lote 13: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT H. sapiens ACTB R, 1 mole Purificação: Standard Desalting Sequência ACTB R: 5 GGTGAGGATCTTCATGAGGTA 3 ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 05 SAPAR 029/2016).
Lote 14: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, Probe ACTB P1, 1 mole Purificação: HPLC Purification Sequência ACTB P1: HEX/CCTGCGTCTGGACCTGGCTG/3BHQ ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 06 SAPAR 029/2016).
Lote 15: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, F3 Sm28SrRNA ,1 mole Purificação: Standard Desalting Sequência F3 5 CCTAGTAACTGCGAGTGAAC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação. (Item 07 SAPAR 029/2016).
Lote 16: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, B3 Sm28SrRNA,1 mole Purificação: Standard Desalting Sequência B3 - 5 AAGTATTTAGCCTTGGATGGAG 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 08 SAPAR 029/2016).
Lote 17: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, FIP Sm28SrRNA,1 mole Purificação: Standard Desalting Sequência FIP -5 GCCGTACTCATTGCTGGACTTCGTAAGGCAATGTGGTGT 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 09 SAPAR 029/2016).
Lote 18: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, BIP Sm28SrRNA,1 mole Purificação: Standard Desalting Sequência BIP - 5 GGCAGAGATCAAGTGTGACAGTCTGCATTCACAAACAACCC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 10 SAPAR 029/2016).
Lote 19: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, LoopF Sm28SrRNA,1 mole Purificação: Standard Desalting Sequência LoopF - 5 AGTAATGCCTGAAGCCACC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 11 SAPAR 029/2016).
Lote 20: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, LoopB Sm28SrRNA,1 mole Purificação: Standard Desalting Sequência LoopB - 5 TTTGCTCTGAGCTACCCTTG 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 12 SAPAR 029/2016).
Lote 21: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, 121F, 1 mole Purificação: Standard Desalting Sequência121F 5 GAT CTG AAT CCG ACC AAC CG 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 13 SAPAR 029/2016).
Lote 22: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, 121R, 1 mole Purificação: Standard Desalting Sequência 121R 5 ATA TTA ACG CCC ACG CTC TC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 14 SAPAR 029/2016).
Lote 23: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, Alfa tubF, 1 mole Purificação: Standard Desalting Sequência Alfa tubF 5´ TAT CCA CTT CCC GTT GGC TAC C 3´, ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 15 SAPAR 029/2016).
Lote 24: DOSADOR QUIMICO. OLIGONUCLEOTIDEO,IDT, Alfa tubR, 1 mole Purificação: Standard Desalting Sequência Alfa tubR 5´ ACG AGG GTC ACA TTT CAC CAT 3´, ou similar que garanta o mesmo padrão de qualidade e eficiência na reação. (Item 16 SAPAR 029/2016).
Lote 25: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Necator americanus F, 1 mole Purificação: Standard Desalting Sequência F - 5 CTGTTTGTCGAACGGTACTTGC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 17 SAPAR 029/2016).
Lote 26: DOSADOR QUIMICO. OLIGONUCLEOTIDEO IDT, Necator americanus R, 1 mole Purificação: Standard Desalting Sequência R - 5 ATAACAGCGTGCACATGTTGC 3 , ou similar que garanta o mesmo padrão de qualidade e eficiência na reação.(Item 18 SAPAR 029/2016).


Aquisição de insumos de uso laboratorial, tais como: oligonucleotídeos, sondas, kits e reagentes.

Lote 1: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR ZIK NS5 ****. Descrição: Sequência: 5 - AAR TAC ACA TAC CAR AAC AAA GTG GT-3 . Escala de síntese: 250 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 01 SAARB 092/2016).
Lote 2: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR ZIK NS5 ****. Descrição: Sequência: 5 - TCC RCT CCC YCT YTG GTC TTG-3 . Escala de síntese: 250 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 02 SAARB 092/2016).
Lote 3: DOSADOR QUIMICO. SONDA TIPO LNA PRIME TIME 5 6-FAM/ZEN/3 IBRFQ, ZIK NS5 **** Descrição: Sequência: 5 - CTY AGA CCA +G+C+T+ GAAR - 3 Escala de síntese: 1 µmol. Modificações: 5 FAM, 3 Iwoa Black FQ , 4 bases de LNA, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitadas e que seja da mesma marca dos demais itens deste TR Apresentação: 1 (um) tubo fosco contendo oligonucleotídeo liofilizado. (Item 03 SAARB 092/2016).
Lote 4: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR - ZIKAV ENV ****. Descrição: Sequência: 5´-CCGCTGCCCAACACAAG-3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 04 SAARB 092/2016).
Lote 5: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR - ZIKAV ENV ****. Descrição: Sequência: 5´-CCACTAACGTTCTTTTGCAGACAT-3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 05 SAARB 092/2016).
Lote 6: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE - ZIKAV ENV **** Descrição: Sequência: 5´-6FAM- AGCCTACCT/ZEN/TGACAAGCAGTCAGACACTCAA-IwBkFQ-3´. Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 6-FAM, Int ZEN, 3 Iowa Black FQ, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 06 SAARB 092/2016).
Lote 7: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR VDEN **** F. Descrição: Sequência: 5´- GGTTAGAGGAGACCCCTCCC -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 07 SAARB 092/2016).
Lote 8: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR - VDEN **** R. Descrição: Sequência: 5´- GAGACAGCAGGATCTCTGGTCT -3´. Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 08 SAARB 092/2016).
Lote 9: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE - VDEN GEN probe Descrição: Sequência: 5´-6FAM- AAACAGCATATTGACGCTGGGA/3BHQ_2/-3´. Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 6-FAM, Int ZEN, 3 Iowa Black FQ, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou similar desde que atenda a exata descrição e forma de apresentação solicitada nesta TR. Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 09 SAARB 092/2016).
Lote 10: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR RNASE P F. Descrição: Sequência: 5 - AGA TTT GGA CCT GCG AGC G -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 10 SAARB 092/2016).
Lote 11: DOSADOR QUIMICO. OLIGONUCLEOTÍDEO SINTÉTICO PERSONALIZADO INICIADOR RNASE P R. Descrição: Sequência: 5 - GAG CGG CTG TCT CCA CAA GT -3 . Escala de síntese: 100 nmoles. Purificação: Dessalinização Padrão. Tubo contendo oligonucleotídeo liofilizado. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 11 SAARB 092/2016).
Lote 12: DOSADOR QUIMICO. SONDA TIPO TAQMAN PRIMETIME PROBE 5 6-HEX/ZEN/3 IBRFQ RNASE P S Descrição: Sequência: 5 - TTC TGA CCT GAA GGC TCT GCG CG -3 . Escala de síntese: 250 nmoles. Purificação: HPLC. Modificações: 5 HEX, Int ZEN, 3 Iowa Black FQ, purificação HPLC. Sugestão: Marca Integrated DNA Technologies IDT, ou equivalente desde que atenda a exata descrição e forma de apresentação solicitadas e que seja da mesma merca dos itens 5 a 22 deste TR Apresentação: 1 (um) tubo contendo oligonucleotídeo liofilizado. (Item 12 SAARB 092/2016).


2.23. CONDIÇÕES PARA PARTIC3.1 3.1.1 3.1.2 w.bllcomprasorg.brAceso Identificado3.1.3 Bolsa de Licitações e eilõesuma hora antes3.1.4 Bolsa de Licitções e **** Instrumento particular de mandatoBolsa de Licitções e **** empresa articipante do cetanão d idtificada224. Dec **** 3.3 3.4 Não poderã participar da presente licitaçã, além dos.ºei 86/93:3.4.1 3.4.2 3.4.3 mesmo quand aplicadspor outros órgãos enidadspúblcas.3.4.4 3.4.5 3.5 3.6 3.7 3.8 . IMPUGNAÇÃO DO AT CONVOCATÓRIaté 02 (d

Assista ao Vídeo |

O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!

Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
Política de privacidade | © 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.