Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Iniciadores |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

PE: HOSPITAL GERAL DE AREIAS-PE

REGISTRO DE PREÇOS PARA MATERIAIS ODONTOLÓGICOS

Lote 3: **** - ADESIVO DE FRASCO UNICO FOTOPOLIMERIZAVEL - SISTEMA ADESIVO DE FRASCO UNICO PRIME + ADESIVA EM UM UNICO FRASCO FOTOPOLIMERIZAVEL PARA ESMALTE E DENTINA SOLVENTE A BASE A ETANOL, CARGA DE NANOPARTICULAS DE SILICA, MONOMEROS METACRILICOS, FOTOINICIADORES, CO-INICIADORES, ESTABILIZANTE, EMBALAGEM EM FRASCO

RS ( SANTA MARIA ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE FEDERAL DE SANTA MARIA (UASG: 153164)

REGISTRO de PREÇOS PARA AQUISIÇÃO DE PRODUTOS QUÍMICOS DESTINADOS AOS DIVERSOS SETORES DA UFSM.

Lote 709: COMPOSTO PRESERVATIVO. Master Mix para PCR em tempo real com corante SYBR® GreenER TM contendo todos os componentes de reação menos a amostra e oligonucleotídeos iniciadores. Frasco com 5 ml..

SP: SEC.DESENV. ECONOMICO, CIENCIA,TECN. INOVACA UNICAMP-CAISM

MATERIAL DE USO LABORATORIAL

Lote 15: OLIGONUCLEOTIDEOS INICIADORES 25 BASES MIE4 25 NANOMOLES PO LIOFILIZ.
Lote 16: OLIGONUCLEOTIDEOS INICIADORES 25 BASES MIE5 25 NANOMOLES PO LIOFILIZ.
Lote 17: OLIGONUCLEOTIDEOS INICIADORES 20 BASES IE1 25 NANOMOLES PO LIOFILIZ.
Lote 18: OLIGONUCLEOTIDEOS INICIADORES 20 BASES IE2 25 NANOMOLES PO LIOFILIZ.

SP: SEC. DESENVOLVIMENTO ECONÔMICO, CIÊNCIA, TECNOLOGIA E INOVAÇAO/UNIV.ESTADUAL DE CAMPINAS - UNICAMP/UNIVERSIDADE ESTADUAL DE CAMPINAS-UNICAMP

Registro de preços de reagentes para rotina diagnostica/EQUIPAMENTOS E ARTIGOS DE USO MEDICO, ODONTOLOGICO, HOSPITALAR E LABORATORIAL/REAGENTES QUIMICOS E BIOLOGICOS

Lote 3: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 26 Bases; Po Liofilizado, B23; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 Tgg Gtc Tac Gtc Gat Ggc Atg Aca Ac; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 4: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Rtg1; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 Ggc Att Cct Cgt Tga Aga Tt; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 5: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 25 Bases; Po Liofilizado, B22; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 Aac Ggg Cga Gta Gca Cct Gag Gag A; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 6: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Rtg2; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 Cct Tgg Ccg Ata Ggt Cta Gg; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 7: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Hl1 512pb; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 TAGAGATAGGAAACCAACTC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 8: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Hl2 512pb; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CTCGGGTTAATGTTGCATGA; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 9: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 18 Bases; Po Liofilizado, P3; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 AGA CAG AGA AGA CTC TTG; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 10: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 21 Bases; Po Liofilizado, P5; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 TCA TTC GTC TGT TTC CCA TTC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 11: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, G73; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 GAA GAG CCA AGG ACA GGT AC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 12: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, G74; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CAA CTT CAT CCA CGT TCA CC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 15: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 25 Bases; Po Liofilizado, Mie4; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CCA AGC GGC CTC TGA TAA CCA AGC C; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 16: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 25 Bases; Po Liofilizado, Mie5; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CAG CAC CAT CCT CCT CTT CCT CTG G; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 17: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Ie1; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CCA CCC GTG GTG CCA GCT CC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****
Lote 18: Oligonucleotideos; Iniciadores; para Uso Em Biologia Molecular; Com 20 Bases; Po Liofilizado, Ie2; Na Concentração de 25 Nanomoles, Com Sequencia 5-3 CCC GCT CCT CCT GAC CAC CC; Validade Mínima de 12 Meses a Partir Da Data de Entrega; Acondicionado Em Frasco Apropriado Que Garanta a Integridade do Produto; Rotulo Com Nome do Produto, Numero de Lote, Data de Fabricação/validade, Composição e Procedência. CCAISM: ****

GO ( ITUMBIARA ): MINISTÉRIO DA EDUCAÇÃO/SECRETARIA EXECUTIVA/SUBSECRETARIA DE PLANEJAMENTO E ORÇAMENTO/INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE GOIÁS/CAMPUS ITUMBIARA (UASG: 158433)

Aquisição de equipamentos para os laboratórios de Engenharia Elétrica, Engenharia de Controle e Automação, Processos e Alimentos e Química, do Instituto Federal de Goiás, Câmpus: Águas Lindas, Anápolis, Aparecida de Goiânia, Cidade de Goiás, Goiânia, Goiânia Oeste, Itumbiara, Luziânia e Valparaíso, conforme condições, quantidades, exigências e estimativas, inclusive as encaminhadas pelos órgãos participantes.

Lote 38: WATTÍMETRO. Wattímetro trifásico para trilho DIN, com as seguintes características mínimas: Referência comercial: Hinking ****. Características gerais: Medida de energia ativa consumida, em kWh; Medição a 4 fios (3 fases e neutro); Resolução de 0,1 kWh, Precisão de +/1% , Conexões através de borne aparafusado para alimentação e carga; Tensão de operação: 380 +/10% (fase-fase), 220 +/10% (fase-neutro); Frequência de operação: 60 Hz; Corrente máxima: 100 A (por fase); Montagem em trilho DIN 35 mm x 7,5 mm; Proteção (acrílico ou plástico) dos terminais de entrada e saída; Iniciador digital de energia consumida, em kWh, com 7 digitos (de 0,0 à ****,9 kWh); Sem possibilidade de zerar a medida, Inclusive na falta de energia; Indicador de energização; Indicador de pulso de consumo; Classe 1 de precisão; 800 pulsos/kWh (800 imp/kWh); Atender as normas IEC **** (Electricity metering equipment (a.c.) Particular requirements Static meters for active energy) e IEC **** (Electricity metering equipment (AC) General requirements, tests and test conditions Metering equipment). Garantia mínima de 01 (um) ano. Manual de instruções..
Lote 39: WATTÍMETRO. Wattímetro trifásico para trilho DIN, com as seguintes características mínimas: Referência comercial: Hinking ****. Características gerais: Medida de energia ativa consumida, em kWh; Medição a 4 fios (3 fases e neutro); Resolução de 0,1 kWh, Precisão de +/1% , Conexões através de borne aparafusado para alimentação e carga; Tensão de operação: 380 +/10% (fase-fase), 220 +/10% (fase-neutro); Frequência de operação: 60 Hz; Corrente máxima: 100 A (por fase); Montagem em trilho DIN 35 mm x 7,5 mm; Proteção (acrílico ou plástico) dos terminais de entrada e saída; Iniciador digital de energia consumida, em kWh, com 7 digitos (de 0,0 à ****,9 kWh); Sem possibilidade de zerar a medida, Inclusive na falta de energia; Indicador de energização; Indicador de pulso de consumo; Classe 1 de precisão; 800 pulsos/kWh (800 imp/kWh); Atender as normas IEC **** (Electricity metering equipment (a.c.) Particular requirements Static meters for active energy) e IEC **** (Electricity metering equipment (AC) General requirements, tests and test conditions Metering equipment). Garantia mínima de 01 (um) ano. Manual de instruções..
Lote 40: WATTÍMETRO. Wattímetro monofásico para trilho DIN, com as seguintes características mínimas: Referência comercial: Hinking ****. Características gerais: Medida de energia ativa consumida, em kWh; Medição a 2 fios (fase e neutro); Resolução de 0,1 kWh Precisão de +/1%; Conexões através de borne aparafusado para alimentação e carga; Tensão de operação: 220 +/10% (fase-neutro), Frequência de operação: 60 Hz; Corrente máxima: 32 A; Montagem em trilho DIN 35 mm x 7,5 mm; Proteção (acrílico ou plástico) dos terminais de entrada e saída; Iniciador digital de energia consumida, em kWh, com 7 dígitos (de 0,0 à ****,9 kWh); Sem possibilidade de zerar a medida, inclusive na falta de energia; Indicador de energização; Indicador de pulso de consumo; Classe 1 de precisão; 800 pulsos/kWh (800 imp/kWh); Atender as normas IEC **** (Electricity metering equipment (a.c.) Particular requirements Static meters for active energy) e IEC **** (Electricity metering equipment (AC) General requirements, tests and test conditions Metering equipment). Garantia mínima de 01 (um) ano. Manual de instruções..
Lote 41: WATTÍMETRO. Wattímetro monofásico para trilho DIN, com as seguintes características mínimas: Referência comercial: Hinking ****. Características gerais: Medida de energia ativa consumida, em kWh; Medição a 2 fios (fase e neutro); Resolução de 0,1 kWh Precisão de +/1%; Conexões através de borne aparafusado para alimentação e carga; Tensão de operação: 220 +/10% (fase-neutro), Frequência de operação: 60 Hz; Corrente máxima: 32 A; Montagem em trilho DIN 35 mm x 7,5 mm; Proteção (acrílico ou plástico) dos terminais de entrada e saída; Iniciador digital de energia consumida, em kWh, com 7 dígitos (de 0,0 à ****,9 kWh); Sem possibilidade de zerar a medida, inclusive na falta de energia; Indicador de energização; Indicador de pulso de consumo; Classe 1 de precisão; 800 pulsos/kWh (800 imp/kWh); Atender as normas IEC **** (Electricity metering equipment (a.c.) Particular requirements Static meters for active energy) e IEC **** (Electricity metering equipment (AC) General requirements, tests and test conditions Metering equipment). Garantia mínima de 01 (um) ano. Manual de instruções..

Estatísticas |

Número de licitações mapeadas com o termo "Iniciadores"

O Licita Já faz mapeamento estatístico e analisa os maiores compradores de seus produtos e serviços!


Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
Política de privacidade | © 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.