Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Polimerase |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

RJ ( RIO DE JANEIRO ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/EMBRAPA/CTAA (UASG: 135020)

Aquisição de Reagentes para o Laboratório de Diagnóstico Molecular da Embrapa Agroindústria de Alimentos

Lote 1: CONJUNTO PARA ANÁLISE. CONJUNTO PARA ANÁLISE, COMPOSIÇÃO BÁSICA MISTURA PARA REAÇÃO, APLICAÇÃO PARA PCR, COMPONENTES TAQ DNA POLIMERASE C/ ANTICORPO, DNTPS, MGCL2, OUTROS COMPONENTES EM SOLUÇÃO TAMPONADA, ÁGUA LIVRE RNASE.
Lote 4: ISOLADOR SUPORTE. Oligonucleotideos com 25 bases ( A, C, G ou T) sem modificações, desalinizados para uso em reação em cadeia da polimerase ( PCR) Condução de reações para detecção de indicadores de qualidade de café. Oligonucleotídeos sem marcação, escala 200 mM, dessanilizados: Hh_ gaba1_ F1 - CTTATGTCTTTCATCGTGTATCGACTA Hh_ gaba1_ R1 - AGGTGAGCTTGGCGTGAGA Hh_ gaba2_ F2 - ATCTTATGTCTTTCATCGTGTATCGACTA Hh_ gaba2_ R2- AGGTGAGCTTGGCGTGAGA Bt- F1- GAGGAAATGCGTATTCAATTCAAC Bt- R TTCTGGACTGCGAACAATGG Pubi- F2 - ATTTGCTTGGTACTGTTTCTTTTG Cry- rr- R - TTGTTGTCCATGGATCCTCTAGAGT.
Lote 6: ENZIMA. ENZIMA, TIPO TAQ DNA POLIMERASE, ASPECTO FÍSICO LÍQUIDO, CARACTERÍSTICAS ADICIONAIS FRASCO SEPARADO DE MGCL2, CONCENTRAÇÃO 5. 000 UI/ ML, COMPONENTES ADICIONAIS TAMPÃO REAÇÃO 10X SEM MGCL2.

RJ ( RIO DE JANEIRO ): MINISTÉRIO DA DEFESA/COMANDO DO EXÉRCITO/COMANDO MILITAR DO LESTE/1ª REGIÃO MILITAR/INSTITUTO DE BIOLOGIA DO EXÉRCITO (UASG: 160324)

Material pesquisa e biodefesa

Lote 19: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Ensaio de detecção de Toxina B de Clostridium difficile toxin B em fezes humanas. Deve conter reagentes para reação em cadeia da Polimerase ( PCR) em tempo real e extracao incluídos no mesmo kit. Deve ser compatível com o aparelho referencia do laboratório BDmáx do fabricante Becton Dickinson ( BD).
Lote 20: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Ensaio de detecção dos genes de resistência: KPC, OXA- 48 e NDM de enterobactérias resistentes às carbapenemases ( CRE). Deve conter reagentes para reação em cadeia da Polimerase ( PCR) em tempo real e EXTRAÇÃO incluídos no mesmo kit. Deve ser compatível com o aparelho referencia do laboratório BDmax do fabricante Becton Dickinson ( BD).
Lote 21: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Ensaio de detecção de Salmonella spp., Campylobacter spp. ( jejuni and coli), Shigella spp. , EIEC, STEC. Deve conter reagentes para reação em cadeia da Polimerase ( PCR) em tempo real e EXTRAÇÃO incluídos no mesmo kit. Deve ser compatível com o aparelho referencia do laboratório BDmáx do fabricante Becton Dickinson ( BD).
Lote 22: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Detecção de DNA de Estreptococus do Grupo B ( GBS) em amostras reto- vaginais de mulheres grávidas de 35- 37 semanas, depois de 18 horas de incubação em LIM Broth ( caldo LIM). Deve conter reagentes para reação em cadeia da Polimerase ( PCR) em tempo real e EXTRAÇÃO incluídos no mesmo kit. Deve ser compatível com o aparelho referencia do laboratório BDmáx..
Lote 23: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Ensaio de detecção de MRSA incluindo novas variantes ( MREJ variants, mecC and mecA) em amostras de swab nasofaríngeo. Deve conter reagentes para reação em cadeia da Polimerase ( PCR) em tempo real e EXTRAÇÃO incluídos no mesmo kit. Deve ser compatível com o aparelho referencia do laboratório BDmáx..
Lote 24: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Ensaio de detecção Duplex de Staph SR e MRSA de amostras provenientes de swab nasofaríngeo. Deve Incluir todas as variantes MRSA XT. Deve conter reagentes para reação em cadeia da Polimerase ( PCR) em tempo real e EXTRAÇÃO incluídos no mesmo kit. Deve ser compatível com o aparelho referencia do laboratório BDmáx..
Lote 25: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Ensaio de detecção de Plasmodium falciparum, P. vivax, P. ovale/ P. malariae, RNAseP. Deve conter reagentes para reação em cadeia da Polimerase ( PCR) em tempo real e EXTRAÇÃO incluídos no mesmo kit. Deve ser compatível com o aparelho referencia do laboratório BDmáx..
Lote 26: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Ensaio de detecção de complexo de Tuberculose. Deve conter reagentes para reação em cadeia da Polimerase ( PCR) em tempo real e EXTRAÇÃO incluídos no mesmo kit. Deve ser compatível com o aparelho referencia do laboratório BDmáx do fabricante Becton Dickinson ( BD).
Lote 27: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Ensaio de detecção de enteroccoco Multiplex vanA, B and C1/ C2, SPC. Deve conter reagentes para reação em cadeia da Polimerase ( PCR) em tempo real e EXTRAÇÃO incluídos no mesmo kit. Deve ser compatível com o aparelho referencia do laboratório BDmáx do fabricante Becton Dickinson ( BD).
Lote 28: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Ensaio de detecção de Patógenos de Meningite Bacteriana- Neisseria meningitidis, Streptococcus pneumoniae, Haemophilus influenzae. Deve conter reagentes para reação em cadeia da Polimerase ( PCR) em tempo real e EXTRAÇÃO incluídos no mesmo kit. Deve ser compatível com o aparelho referencia do laboratório BDmáx do fabricante Becton Dickinson ( BD).
Lote 29: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Ensaio de detecção de MERS Corona Virus. Deve conter reagentes para reação em cadeia da Polimerase ( PCR) em tempo real e EXTRAÇÃO incluídos no mesmo kit. Deve ser compatível com o aparelho referencia do laboratório BDmáx do fabricante Becton Dickinson ( BD).
Lote 30: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Ensaio de detecção de Pneumonia atípica - Mycoplasma pneumoniae, Legionella, Chlamydia pneumonia, SPC. Deve conter reagentes para reação em cadeia da Polimerase ( PCR) em tempo real e EXTRAÇÃO incluídos no mesmo kit. Deve ser compatível com o aparelho referencia do laboratório BDmáx do fabricante Becton Dickinson ( BD).
Lote 34: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. PCR Master Mix 2 vezes concentrada, com Taq DNA Polimerase, dNTPs, MgCl2 e tampão de reação..
Lote 48: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Master mix para reações com sonda ( probe) em uma etapa ( One Step) de transcrição reversa ( RT- qPCR) para análise de RNA. O reagente deve conter no mesmo tubo, transcriptase reversa e Taq polimerase de alta eficiência, referencia passiva do fabricante THERMOFISHER..
Lote 81: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Enzima Taq DNA polimerase ( 5U/ uL), tecnologia hot start, para amplificação de fragmentos de até 10Kb. Contendo tampão sem MgCl2, o qual deve integrar o kit em tubo separado na concentração de 50mM..
Lote 82: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Enzima Taq DNA polimerase de alta fidelidade de replicação ( 5U/ uL), tecnologia hot start, para amplificação de fragmentos de até 15Kb. Contendo 50mM de MgSO4 em tubo separado, do fabricante THERMOFISHER..
Lote 88: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Sistema multiplex de identificação humana para amplificação de 24 marcadores STR autossômicos mais amelogenina, incluindo os paineis CODIS e ESS, contendo primers marcados com corantes fluorescentes. O Kit deve conter um tubo mix de reação, Taq DNA polimerase Hot Start, Escada Alélica e DNA controle. Devendo ser compatível com a plataforma ABI Prism **** Genetic Analyzer..
Lote 89: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Sistema multiplex de identificação Humana para amplificação de 23 ou 24 marcadores do cromossomo Y, contendo primers marcados com corantes fluorescentes. O kit deve conter um tubo mix de reação, Taq DNA polimerase Hot Start, Escada alélica e DNA controle. Devendo ser compatível com a plataforma ABI Prism **** Genetic Analyzer..
Lote 118: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Kit de alta performance para amplificação de DNA, contendo enzima Taq DNA Polimerase Hot Start, bloqueio da atividade enzimática por anticorpo, 5U/ Ul. O tampão não deve conter cloreto de magnésio. Tubo com 25mM de cloreto de magnésio formecido separadamente. Fabricante PROMEGA..
Lote 133: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Kit para amplificação de 30 polimorfismos inserção/ deleção ( INDELs) incluindo Amelogenina. Aplicável para análise de DNA altamente degradado, com tamanho máximo de amplicon de 150 bp. O kit deverá incluir mix de primers, mix de reação, Taq DNA polimerase, controle positivo de DNA humano, padrão de tamanho e escada alélica do fabricante QIAGEN. Suficiente para 100 reações..
Lote 13: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Bota de segurança em PVC, o par, com forro, na cor branca. Obs.: o número da bota será informado no ato da realização do empenho..

RR ( BOA VISTA ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/EMBRAPA/CPAF-RORAIMA (UASG: 135005)

Registro de Preços para eventual aquisição de MATERIAIS E REAGENTES PARA LABORATÓRIO

Lote 61: ENZIMA. ENZIMA, TIPO TAQ DNA POLIMERASE, ASPECTO FÍSICO LÍQUIDO, CARACTERÍSTICAS ADICIONAIS FRASCO SEPARADO DE MGCL2, CONCENTRAÇÃO 5. 000 UI/ ML, COMPONENTES ADICIONAIS TAMPÃO REAÇÃO 10X SEM MGCL2.
Lote 81: ENZIMA. ENZIMA, TIPO TAQ DNA POLIMERASE, ASPECTO FÍSICO LÍQUIDO, CONCENTRAÇÃO 5. 000 UIML, COMPONENTES ADICIONAIS TAMPÃO REAÇÃO 10X COM MGCL2.

CE ( SOBRAL ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/EMBRAPA/CNPC (UASG: 135010)

Aquisição de material e reagentes para laboratorios

Lote 47: ENZIMA. ENZIMA, TIPO TAQ DNA POLIMERASE, ASPECTO FÍSICO LÍQUIDO, CARACTERÍSTICAS ADICIONAIS MGLC2, ANTICORPO INIBIDOR, SOLUÇÃO INTENSIFICADOR A, CONCENTRAÇÃO **** U/ ML, COMPONENTES ADICIONAIS TAMPÃO REAÇÃO 10X.

PE ( PETROLINA ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/EMBRAPA/CPATSA (UASG: 135012)

Reagentes, Vidrarias e Materiais de Laboratorio

Lote 40: ACESSÓRIOS PARA ESTUDO/ TREINAMENTO. DNTP set, conjunto de 4 tubos de 250 µ L na concentração de 100mM ( dATP, dCTP, dGTP, dTTP). Uso em PCR e transcrição reversa. O conjunto de dNTP 100 mM consiste em quatro desoxinucleótidos ( dATP, dCTP, dGTP, dTTP), cada um com uma concentração de 100 mM. Os desoxinucleótidos são adequados para utilização na reação em cadeia da polimerase ( PCR), seqüenciamento, preenchimento, tradução de nick, síntese de cDNA e reações de retaguarda TdT. Os nucleotídeos são fornecidos como soluções prontas para uso. Concentração: 100 mM Tamanho do produto: 4 x 250 L Condição de Envio: Envio congelado / GELO SECO / - 20 GRAU.

Estatísticas |

Número de licitações mapeadas com o termo "Polimerase"

O Licita Já faz mapeamento estatístico e analisa os maiores compradores de seus produtos e serviços!


Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
Política de privacidade | © 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.