Buscador de Licitações
SP (11) 3522-9930 | (14) 3042-1818 | (16) 4042-1850 | (19) 4042-5040
RJ (21) 3527-0150 | MG (31) 4063-9920 | PR (41) 4063-9885
SC (48) 4052-9885 | (49) 991-088-088 | RS (51) 4063-9920
DF (61) 4063-7750 | GO (62) 3142-0111 | MS (67) 4042-1899
BA (71) 4062-9930 | PE (81) 4042-1599


(11) 3522-9930

ver outros
Licita Já! O melhor buscador de licitações e pregões.

Teste Grátis |


Cadastre-se já e tenha acesso completo ao buscador mais inovador do mercado!
Conte com o Licita Já para encontrar as melhores licitações de seu segmento de forma fácil e direta.
O Licita Já não solicitará outras informações pessoais nem financeiras para a realização do teste grátis.

Período Promocional |


O teste gratuito garante acesso completo ao sistema por 10 dias. Ache fácil suas licitações e aumente seu faturamento já!

Licitações para Primer |

Para acessar todas as licitações e baixar os editais, faça já seu teste grátis.

MG: POLICIA MILITAR DE MINAS GERAIS - CAE/APM

Para atender a demanda da PMMG - CAM

Lote 1: Materiais de construção e reforma./ TIJOLO - MATERIA- PRIMA: BARRO COZIDO; TIPO: FURADO; MEDIDAS: 14 X 19 X 29CM;/ AREIA - TIPO: LAVADA MEDIA;/ PORTA - TIPO DA MADEIRA: MADEIRA, NUCLEO SARRAFEADO, CAPA LISA EM HDF; ACABAMENTO: PRIME PARA PINTURA; DIMENSOES: ****( FOLHA MEDIA);/ CARPETE - MATERIA- PRIMA: NYLON; ESPESSURA: 6MM (+ OU- 10%); COR: A SER DEFINIDA PELO ORGAO;/ PARAFUSO COM FENDA - MATERIA- PRIMA: FERRO GALVANIZADO; CABECA: REDONDA; ROSCA: SOBERBA; MEDIDAS: 3, 5 X 25MM;/ CAL - TIPO: HIDRATADA;/ CIMENTO - TIPO: PORTLAND COMPOSTO; TIPO 2: CP II E32;/ PORTA - TIPO DA MADEIRA: SECA, REFLORESTAMENTO; ACABAMENTO: LISO EM PRIMER; DIMENSOES: 2, 10 X 0, 80 METROS;/ ARAME DE ACO RECOZIDO PARA CONSTRUCAO CIVIL - BITOLA: 1, 25MM, NR 18 ( PG- 07); FINALIDADE: ARMACAO DE LAGES, PILARES ETC;/ FECHADURA - MATERIA- PRIMA: ZAMAC; TIPO: ALAVANCA, BROCA 55MM; UTILIZACAO: PORTA EXTERNA;/ PORTA - TIPO DA MADEIRA: IPE; ACABAMENTO: TIPO PRANCHETA REFORCADA; DIMENSOES: 0, 90M X 2, 10M; ESPESSURA 3, 5CM;/ ARGAMASSA - COMPOSICAO: CIMENTO+ CALCARIO DOLOMITA+ AREIA QUARTZO+ ADITIVOS; APLICACAO: EXTERNO; TIPO: ACI;/ TINTA PARA USO IMOBILIARIO - TIPO: ACRILICA; ACABAMENTO: ACETINADO; COR: BRANCO GELO; COMPOSICAO: DISPERSAO AGUOSA COM POLIMERO ACRILICO; FINALIDADE: ALVENARIA INTERIOR E EXTERIOR; QUALIDADE: PRIMEIRA QUALIDADE;/ PREGO - MATERIA- PRIMA: FERRO GALVANIZADO; TAMANHO: 12 X 12; CABECA: COM CABECA; ACABAMENTO: .;/ ARGAMASSA - COMPOSICAO: CIMENTO ESTRUTURAL; APLICACAO: INTERNO E EXTERNO ( PARA PISO E PAREDE); TIPO: ACI - NA COR CINZA;/ ADESIVO PARA REJUNTE/ COLAGEM DE PISO - COR: CINZA; TIPO: BICOMPONENTE EPOXI ISENTO DE AGUA;/ AREIA - TIPO: LAVADA GROSSA;/ TINTA PARA USO IMOBILIARIO - TIPO: ACRILICA; ACABAMENTO: FOSCO; COR: BRANCO NEVE; COMPOSICAO: RESINA ACRILICA A BASE DE AGUA; FINALIDADE: ALVENARIA INTERIOR E EXTERIOR; QUALIDADE: PRIMEIRA QUALIDADE;/ GRANITO - COR: CINZA ANDORINHA; ESPESSURA: 2CM ESPESSURA; ACABAMENTO: POLIDO EM UMA FACE E BORDAS; APLICACAO: PISO, SOLEIRA E RODAPE;/ BRITA - NUMERO: 1; TIPO: GNAISE;

SP: SEC. SAÚDE/HOSP. DAS CLÍNICAS DA FAC.DE MED.DA USP/HC.DA FACULDADE DE MEDICINA DA UNIV.S.PAULO

reagentes e insumos para uso laboratorial/ EQUIPAMENTOS E ARTIGOS DE USO MEDICO, ODONTOLOGICO, HOSPITALAR E LABORATORIAL/ INSUMOS DE EQUIPAMENTOS DE USO LABORATORIAL

Lote 3: ENSAIO CUSTOMIZADO TAQMAN DE EXPRESSAO GENICA PARA DETECÇAO DO HERPES SIMPLES I/ II, ESCALA MÉDIA, 20X CONCENTRADO. PRIMERS E SONDA DESCRITA NO MEMORIAL DESCRITIVO. ****

DF ( BRASÍLIA ): MINISTÉRIO DA DEFESA/COMANDO DA AERONÁUTICA/COMANDO-GERAL DE OPERAÇÕES AÉREAS/NUCLEO DO GRUPAMENTO DE APOIO DO DISTRITO FEDERAL (UASG: 120625)

Registro de preços para eventual aquisição de material de construção e ferramentas para o GAP- DF e Unidades Apoiadas, conforme condições, quantidades e exigências estabelecidas no Edital e seus anexos.

Lote 83: PRIMER. PRIMER, COMPONENTE BÁSICO ASFALTO MODIFICADO, PLASTIFICANTES, SOLVENTES ORG Â, FINALIDADE ADERÊNCIA ENTRE SUPERFÍCIE DE CONCRETO E A MANTA, APLICAÇÃO MANTA ASFÁLTICA.

RS ( BAGÉ ): MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO/EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA/EMBRAPA/CPPSUL (UASG: 135035)

Compra de material laboratorial para Embrapa Pecuaria Sul

Lote 69: CONJUNTO PARA ANÁLISE. CONJUNTO PARA ANÁLISE, APLICAÇÃO P/ SÍNTESE CDNA FITA SIMPLES, COMPONENTES C/ PRIMERS, ÁGUA LIVRE RNASE, COMPONENTES ADICIONAIS MISTURA REAÇÃO, SOLUÇÃO DTT.

PA ( BELÉM ): MINISTÉRIO DA EDUCAÇÃO/UNIVERSIDADE FEDERAL DO PARÁ/PRÓ REITORIA DE ADMINISTRAÇÃO/DEPARTAMENTO DE RECURSOS MATERIAIS (UASG: 153063)

Aq. de material de consumo laboratorial para área de biologia molecular.

Lote 10: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Kit para cDNA ( transcriptase reversa High- Capacity cDNA Reverse Transcription Kit, para 200 reações. Providos de enzima, tampão, primer randômico e Oligo DT, água extra pura e todos os reagents necessaries para a síntese do cDNA.
Lote 26: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MTAMZ_ f_ L Sequência: ATGCCTGATCCATGCTGT Escala: 50nmol Purificação: HPLC.
Lote 27: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MTAMZ_ r_ L Sequência: CAGCACTTGCAGGCTTAG Escala: 50nmol Purificação: HPLC.
Lote 28: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MTAMZ_ f_ O2 Sequência: CTCCAAGGGAGACTGCAAAGG Escala: 25nmol Purificação: DST.
Lote 29: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MTAMZ_ r_ O2 Sequência: AGTTCTTGGCGCAGTCATCAG Escala: 25nmol Purificação: DST.
Lote 30: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MTAMZ_ f_ O1 Sequência: TCCAAGGGAGACTGCAAAGG Escala: 25nmol Purificação: DST.
Lote 31: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MTAMZ_ r_ O1 Sequência: GTTCTTGGCGCAGTCATCAG Escala: 25nmol Purificação: DST.
Lote 32: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): RBCLMLR_ f_ O2 Sequência: TCCAGCAACGGGAGTTATCG Escala: 25nmol Purificação: DST.
Lote 33: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): RBCLMLR_ r_ O2 Sequência: TTCGAGCCCAATGTGCCATA Escala: 25nmol Purificação: DST.
Lote 34: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): RBCLMLR_ f_ O5 Sequência: GGTCCAGCAACGGGAGTTAT Escala: 25nmol Purificação: DST.
Lote 35: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): RBCLMLR_ r_ O5 Sequência: CGAGCCCAATGTGCCATACT Escala: 25nmol Purificação: DST.
Lote 36: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): RBCLMLR_ f_ O4 Sequência: ACGGGAGTTATCGTTGAGCG Escala: 25nmol Purificação: DST.
Lote 37: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): RBCLMLR_ r_ O4 Sequência: TCGAGCCCAATGTGCCATAC Escala: 25nmol Purificação: DST.
Lote 38: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): CATLAMZ_ f_ O7 Sequência: TGGACACTTGTCCTTCCAGC Escala: 25nmol Purificação: DST.
Lote 39: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): CATLAMZ_ r_ O7 Sequência: TGCTCTTGTTCCTGGTGAGC Escala: 25nmol Purificação: DST.
Lote 40: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): AAMIAMZ_ f_ O10 Sequência: CAGCTGGAACCTACTGCGAG Escala: 25nmol Purificação: DST.
Lote 41: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): AAMIAMZ_ r_ O10 Sequência: GCAGATAGCGAAGACGGGTT Escala: 25nmol Purificação: DST.
Lote 42: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): TRIPAMZ_ f_ O7 Sequência: GGAGGAAGCCGATTCCCATT Escala: 25nmol Purificação: DST.
Lote 43: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): TRIPAMZ_ r_ O7 Sequência: ACAGGAGTGGTACCTTCCGA Escala: 25nmol Purificação: DST.
Lote 44: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MMRAMZ_ f_ O2_ S1 Sequência: AGACGCAATGTTCAGCGGTA Escala: 25nmol Purificação: DST.
Lote 45: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Oligonucleotídeos ( primers): MMRAMZ_ r_ O2_ S1 Sequência: TTGTGGTCGCCGTAAGTGAA Escala: 25nmol Purificação: DST.
Lote 4: PEÇAS / ACESSÓRIOS EQUIPAMENTOS ESPECIALIZADOS. Tubos do tipo eppendorff - Microtubo para PCR 0, 2ml. Cx/ mil Tubo cônico para PCR ( inclui tampa chata), descartável, volume de 0, 2 mililitros, marca SSI, com as seguintes características: - Incolor, em resina de grau médico ( polipropileno puro); - Volume: 0, 2 ml; - Autoclavável; - Adequado para PCR em tempo real - tampa transparente ; - Testado por lote e certificado: ausência de nucleases ( DNase e RNase), DNA, pirogênios e inibidores de PCR; - Embalagem: 01 pacote com **** tubos..

Estatísticas |

Número de licitações mapeadas com o termo "Primer"

O Licita Já faz mapeamento estatístico e analisa os maiores compradores de seus produtos e serviços!


Assista ao Vídeo |


O Licita Já é o buscador de licitações mais inovador do mercado. Encontre os pregões mais recentes e receba boletins por e-mail. Clique aqui e faça seu teste grátis.

Veja muito mais!


Teste grátis com acesso ilimitado!
Encontre as melhores licitações e baixe os editais usando palavras chave e regiões de seu interesse.

Clique aqui e Teste Já!

SP - São Paulo: (11) 3522-9930
SP - Campinas: (19) 4042-5040
SP - Ribeirão Preto: (16) 4042-1850
SP - Bauru: (14) 3042-1818
RJ - Rio de Janeiro: (21) 3527-0150
MG - Belo Horizonte: (31) 4063-9920
PR - Curitiba: (41) 4063-9885
SC - Florianópolis: (48) 4052-9885
SC - Videira: (49) 991-088-088
RS - Porto Alegre: (51) 4063-9920
DF - Brasília: (61) 4063-7750
GO - Goiânia: (62) 3142-0111
MS - Campo Grande: (67) 4042-1899
BA - Salvador: (71) 4062-9930
PE - Recife: (81) 4042-1599
WhatsApp: (49) 99954-9401
E-mail: licitaja@licitaja.com.br
Fale conosco
Política de privacidade | © 2011-2017 Licita Já é marca registrada do Portal Genial. Todos os direitos reservados.